Translate this page into:
Activation of p38MAPK and NRF2 signaling pathways in the toxicity induced by chlorpyrifos in Drosophila melanogaster: Protective effects of Psidium guajava pomífera L. (Myrtaceae) hydroalcoholic extract
⁎Corresponding author at: Universidade Federal do Pampa, Campus São Gabriel, Av. Antonio Trilha 1847, Centro, São Gabriel, RS 97300-000, Brazil. Tel.: +55 553237 0851 (2637). jefersonfranco@unipampa.edu.br (Jeferson Luis Franco) jefersonfranco@gmail.com (Jeferson Luis Franco)
-
Received: ,
Accepted: ,
This article was originally published by Elsevier and was migrated to Scientific Scholar after the change of Publisher.
Peer review under responsibility of King Saud University.
Abstract
Chlorpyrifos (CP) is an organophosphate insecticide widely used in the control of agriculture and domestic pests. Occupational exposure is a major form of human poisoning by organophosphates and current therapies for these compounds are not completely efficient. Psidium guajava is a plant widely used in folk medicine and its antioxidant activity has been described. In this study we evaluated the antioxidant and protective potential of the hydroalcoholic extract of P. guajava (HEPG) against CP induced toxicity in the fruit fly Drosophila melanogaster. HEPG in vitro antioxidant activity was confirmed by ABTS, DPPH, Total Phenolics and FRAP assays. The exposure of flies to CP caused increased mortality, locomotor deficits and inhibition of acetylcholinesterase. Flies exposed to CP presented elevated ROS and lipid peroxidation which was accompanied by a significant decrease in mitochondrial viability. As a response to increased oxidative stress, CP exposed flies showed increased GST activity and GSH levels. The mRNA expression of NRF2 and MPK2 (which encodes D. melanogaster p38MAPK) was also significantly up-regulated. HEPG was able to restore all the damage and biochemical/molecular alterations caused by CP. Our results show for the first time the P. guajava potential protective effect against the toxicity caused by chlorpyrifos.
Keywords
Organophosphate compound
Oxidative stress
Natural compounds
Protective effects
1 Introduction
Organophosphate pesticides (OP) are neurotoxic agents widely used for agricultural, industrial, household and warfare purposes. They are active constituents of several household insecticides being still widely used in developing countries despite its controlled use (Soltaninejad and Shadnia, 2014). Chlorpyrifos (CP) is an agrochemical belonging to the class of OP widely used in agriculture as an insecticide due to its lower persistency and higher biodegradability as well as its broad spectrum of activity against arthropods (Breslin et al., 1996). Occupational exposure is a major form of human contamination by organophosphates (Hernández et al., 2008).
Chlorpyrifos exerts its toxicity by inhibiting the enzyme acetylcholinesterase (AChE), which is involved in the control of cholinergic neurotransmission (Li and Han, 2004; Yu et al., 2008). Inhibition of AChE leads to accumulation of the neurotransmitter acetylcholine in the synaptic cleft and promotes hyperexcitation at central nervous system and neuromuscular junctions, causing disturbance of normal physiological functioning (Chakraborty et al., 2009). Another mechanism of toxicity attributed to the CP is the generation of reactive oxygen species (ROS) and depletion of antioxidant defense systems, characterizing an oxidative stress condition (Jett and Navoa, 2000; Goel et al., 2005). Under normal physiological conditions (Bachschmid et al., 2013), ROS are important for normal cell function, but in high amounts they can lead to cellular and tissue damage (Gupta et al., 2010). The mechanisms of cell response to oxidative stress induced by CP and other OP compounds are not fully understood and the understanding of such mechanisms is key factor in the development of effective therapeutic strategies.
The organisms have systems responsible for protecting against damage caused by reactive species. The signaling pathway of NRF2 transcription factor (nuclear factor erythroid 2-like 2) is considered the utmost defense system against oxidative stress and toxicants (Zang et al., 2015). NRF2 is a transcription factor that controls both basal and inducible expression of a variety of antioxidant and detoxification enzymes, including glutathione S-transferase, superoxide dismutase, catalase, thioredoxin reductase, glutathione peroxidase and others (Chen et al., 2015).
Treatment of OP poisoning is based primarily on the use of benzodiazepines atropine and oximes (Peter et al., 2014). However, these therapies are not completely effective and several aspects other than cholinesterase inhibition (e.g. oxidative stress) caused by OP poisoning may not be significantly influenced by current therapeutic strategies. Therefore, there is a need for the search of alternative treatments for the mitigation of OP toxicity. In this sense the search for natural compounds with antioxidant and protective activity for biotechnological and health applications has been intensified (Williams et al., 2004; Wagner et al., 2006).
In a worldwide comparison, Brazil has the highest plant biodiversity, with an estimate over 20% of the total number of botanical species on the planet. Psidium guajava L. var. pomífera (Myrtaceae), popularly known as guava, is found throughout South America, at tropical and subtropical regions and adapts to different climatic conditions (Gutiérrez et al., 2008).
The medicinal properties of guava have been investigated by scientists since the 1940s (Gutiérrez et al., 2008). P. Guajava is widely used in folk medicine against several conditions such as diarrhea, cramps, colitis, dysentery, anorexia, cholera, diarrhea, digestive problems, gastric insufficiency, inflammation, laryngitis, skin problems, pain, ulcers, and others (Cybele et al., 1995; Holetz et al., 2002; Gutiérrez et al., 2008). The antioxidant activity of guava has been described and attributed mainly to constituents found in the leaves and fruits as ascorbic acid and phenolic compounds such quercetin, gallic acid and caffeic acid (Jimenez et al., 2001).
In the present study we aimed to evaluate the antioxidant and protective potential of the hydroalcoholic extract of P. guajava (HEPG) against organophosphate chlorpyrifos induced toxicity in the fruit fly Drosophila melanogaster.
2 Material and methods
2.1 Chemicals
Chlorpyrifos Pestanal® (45395), sucrose (S5016), Reduced glutathione (GSH; G4251-5G), tetramethylethylenediamine (TEMED; T9281), Quercetin (Q4951), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; M2128-1G), 5,5-dithiobis (2-nitrobenzoic acid) DTNB (D8130), acetylthiocholine iodide (A5751), 1-Chloro, 2,4-dinitrobenzene (CDNB; 237329), 2′,7′-dichlorofluorescein diacetate (DCFH-DA; 35845), D-Mannitol (m9647), K2KO4P (1110216), KH2PO4 (P0662), HEPES (Titration; H3375), Albumin from bovine serum (BSA; A6003), Resazurin sodium salt (R7017), Triton X-100 (T8532) were obtained from Sigma–Aldrich (São Paulo, SP, Brazil), SYBR Select Master Mix Applied (4472908) from Biosystems by Life Technologies, DNAse I Amplification Grade – Invitrogen (18068-15) by Life Technologies and iScript cDNA Synthesis kit (1708891) from Biorad. All other chemicals and reagents used here were of the highest analytical grade.
2.2 D. melanogaster stock and media
D. melanogaster (Harwich strain) was obtained from the National Species Stock Center, Bowling Green, OH, USA. The flies were maintained in incubators at 25 ± 1 °C, 12 h dark-light photoperiod and 60–70% relative humidity. The basic cornmeal diet was composed of cereal flour, corn flour, water, antifungal agent (Nipagin) and supplemented with dried yeast as previously described (Paula et al., 2012).
2.3 Plant material and hydroalcoholic extract of P. guajava (HEPG)
The plant material of P. guajava L. var. pomífera, was collected in the Horto Botânico de Plantas Medicinais do Laboratório de Pesquisa de Produtos Naturais (LPPN) of Universidade Regional do Cariri (URCA), Ceará State, Brazil. The plant material was identified, and a voucher specimen was deposited in the Herbarium Dardano Andrade Lima of URCA, under #3930. The extract was prepared by immersing 216 g leaves in 2.6 L of ethanol and water (1:1) for 72 h at room temperature, which was filtered and concentrated using a vacuum rotary evaporator (model Q-344B- Quimis, Brazil) and warm water bath (model Q214M2- Quimis Brazil), obtaining a yield of crude extract of 8 g.
2.4 In vitro antioxidant activity determination
2.4.1 DPPH⋅Radical Scavenging Assay
The scavenging activity toward 2,2-diphenyl-1 picrylhydrazyl (DPPH⋅) radical was evaluated according to the method of Baltrušaitytė et al. (2007) with minor modifications. In brief, 100 μL of DPPH⋅(300 μM) diluted in ethanol was mixed with 20 μL of HEPG (200 μg/mL) in a 96 well microtiter plate. The final volume of each well was adjusted to 300 μL with ethanol. Ascorbic acid was used as a positive control. The absorbance was determined at 517 nm after 45 min incubation. The results were expressed as mg of ascorbic acid equivalents (AAEs) per 100 mg HEPG (Piljac-Žegarac et al., 2009).
2.4.2 ABTS + Radical Scavenging Assay
The antioxidant activity of HEPG in the reaction with ABTS⋅+ radical was determined according to the method of Baltrušaitytė et al. (2007) with some modifications. ABTS⋅+ radical solution was generated by oxidation of solutions prepared of 1 mL of 7 mM 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt stock solution with 17.5 μL of 140 mM potassium persulfate (K2S2O8). 200 μL of ABTS⋅+ solution was mixed with 10 μL of HEPG (200 μg/mL) in a microplate and the decrease in the absorbance was measured after 10 min. Ascorbic acid (1 mM) was used as a positive control. The results were expressed as mg of ascorbic acid equivalents (AAEs) per 100 mg HEPG (Piljac-Žegarac et al., 2009).
2.4.3 Total phenolics
Phenolic compounds from HEPG samples were detected by the Folin–Ciocalteu method with minor modifications (Cruz et al., 2014). HEPG (200 μg/mL) was mixed with 35 μL 1 N Folin–Ciocalteu’s reagent. After 3 min, 70 μL 15% Na2CO3 solution was added to the mixture and adjusted to 284 μL with distilled water. The reaction was kept in the dark for 2 h, after which the absorbance was read at 760 nm. Gallic acid was used as standard (10–400 μg/mL). The results were expressed as mg of gallic acid equivalents (GAEs) per 100 g HEPG.
2.4.4 Ferric reducing antioxidant power (FRAP)
The reducing capacity of HEPG was assayed with the original method of Benzie and Strain (1996), adjusted to analysis of extract samples. 9 μL of HEPG (200 μg/mL) was mixed with 270 μL of freshly prepared FRAP reagent. The FRAP reagent was prepared by mixing 2.5 mL of 0.3 M acetate buffer pH 3.6 with 250 μL of 10 mM 2,4,6-Tris(2-pyridyl)-s-triazine (TPTZ) solution and 250 μL of FeCl3·6H2O. The mixture was shaken and left in a water bath for 30 min and the absorbance readings were taken at 595 nm. Ammonium iron (II) sulfate hexahydrate was used to calculate the standard curve (100–2000 μM). The reducing ability of extract was expressed as μM of Fe (II) equivalent per 100 g HEPG (Cruz et al., 2014).
2.4.5 Mitochondrial activity (MTT reduction test) and ROS production (DCF-DA assay) in vitro
For the determination of mitochondrial activity in vitro, the MTT test was employed and DCF-DA assay was used for monitoring ROS production. A mitochondria enriched homogenate was obtained by homogenizing 1000 flies in 8 mL of mitochondrial Isolation Buffer (220 mM mannitol, sucrose 68 mM, 10 mM KCl, 10 mM HEPES, 1% BSA) in a glass-glass tissue grinder (Kimble Chase, Mexico) and then centrifuged at 1000 g for 10 min. The obtained supernatant was isolated and incubated for 1 h with 500 μM tert-butyl hydroperoxide (TBOOH) and/or HEPG 3.3 μg/mL. After the incubation period, the MTT and DCF-DA tests were carried out according to described elsewhere (Franco et al., 2007; Pérez-Severiano et al., 2004).
2.5 Experimental procedure
Adult female flies (1–4 days) were left, overnight, in glass tubes containing filter paper soaked in 1% sucrose for acclimation to new diet. For the experiments, 30 flies per group were kept in glass tubes containing filter paper soaked with 250 μL of each treatment solution. The experimental groups were as follows: Control (received 1% sucrose solution only), CP 0.75 ppm (diluted in 1% sucrose solution), HEPG at concentrations of 10, 20 and 50 mg/mL (diluted in 1% sucrose solution) and CP + HEPG (at concentrations previously mentioned). After the period of treatment (24 h), mortality, behavioral tests, biochemical and molecular analysis were performed. Lethal chlorpyrifos concentrations were previously determined by our group (unpublished data). The LC50 24 h in adult female flies was 1.182 ppm, so for this study the sublethal concentration of 0.75 ppm CP during 24 h was chosen.
2.6 Mortality and locomotor activity
After finished the treatments, the number of dead flies was recorded and expressed as percentage of survived flies compared to the control (considered 100%). Locomotor activity was determined as negative geotaxis behavior assays (climbing ability) in both individual flies (Bland et al., 2009) and collective flies (Coulomn and Birman, 2004) with some modifications. For the individual test, a total number of 20 flies per group were anesthetized individually placed in vertical glass tubes (length 25 cm, diameter 1.5 cm) closed with cotton wool. After 30 min of recovery the flies were gently tapped to the bottom of the tube and the time taken by each fly to climb 6 cm in the glass column was recorded. The test was repeated 3 times with 20 s intervals for each fly. To test the collective negative geotaxis, 10 flies per group were anesthetized and placed in a glass tube. After 30 min of recovery the flies were gently tapped to the bottom of the tube and the number of flies able to climb over a 6 cm mark in the tube was computed. The tests were repeated 3 times with 20 s intervals for each group of 10 flies. Eight groups of each treatment were counted. The results were expressed as percentage of control.
2.7 Sample preparation
After treatments were finished, twenty flies per group were homogenized in 1000 μl of mitochondrial isolation buffer (220 mM mannitol, sucrose 68 mM, KCl 10 mM, 10 mM HEPES, 1% BSA) following centrifugation at 1000 g for 10 min (4 °C). The mitochondrial-enriched supernatant was used for determination of mitochondrial viability (Resazurin and MTT tests), ROS formation (DCF-DA assay), lipid peroxidation (TBARS) and thiols content. For measurements of enzymes activity, twenty flies per group were homogenized in 20 mM HEPES buffer (pH 7.0). The homogenate was passed through a thin mesh fabric to remove debri and centrifuged at 1000g for 10 min (4 °C). An aliquot of the first supernatant (S1) was used for measurements of cholinesterase activity; the remaining S1 was centrifuged at 20,000g for 30 min (4 °C) (Eppendorf 5427R, rotor FA-45-30-11). The supernatant was isolated and used for measuring the activity of antioxidant enzymes (SOD, CAT and GST) based on protocols previously described. The protein concentration at all samples was determined by the method of Bradford (1976).
2.8 Enzyme assays
Acetylcholinesterase (AchE) activity was assayed following protocols previously described (Ellman et al., 1961). Glutathione S-transferase (GST) activity was assayed following the procedure of Habig and Jakoby (1981) using 1-chloro 2,4-dinitrobenzene (CDNB) as substrate. The assay is based on the formation of the conjugated complex of CDNB and GSH at 340 nm. The reaction was conducted in a mix consisting of 0.1 M phosphate buffer pH 7.0, 1 mM EDTA, 1 mM GSH, and 2.5 mM CDNB. Catalase activity was assayed following the clearance of H2O2 at 240 nm in a reaction media containing 0.05 M phosphate buffer pH 7.0, 0.5 mM EDTA, 10 mM H2O2, 0.012% TRITON X100 according to the procedure of Aebi (1984). Superoxide dismutase (SOD), activity was based on the decrease in cytochrome c reduction (Kostyuk and Potapovich, 1989). All spectrophotometric assays were performed in a Agilent Cary 60 UV/VIS spectrophotometer with a 18 cell holder accessory coupled to a Peltier Water System temperature controller.
2.9 Thiol status
Glutathione (GSH) was measured as non-protein thiols based on Ellman (1959) with minor modifications (Franco et al., 2006). Protein thiols (PSH) were measured spectrophotometrically using Ellman’s reagent. The pellet from the GSH assay was washed with 0.5 M perchloric acid and incubated for 30 min at room temperature in the presence of a solution containing 0.15 mM DTNB, 0.5 M Tris–HCl, pH 8.0, and 0.1% SDS. PSH was estimated using the molar extinction coefficient of 13600/M/cm. A sample blank without Ellman’s reagent was run simultaneously.
2.10 Mitochondrial activity assays
The viability of mitochondrial enriched-fractions obtained from treated flies was used as an index of toxicity induced by exposure to CP. Mitochondrial activity was measured by two tests: resazurin assay (fluorescence) and MTT reduction assay (colorimetric). Resazurin assay is based on the ability of viable mitochondria to convert resazurin into a fluorescent end product (resorufin). Nonviable samples rapidly lose metabolic capacity and thus do not generate a fluorescent signal (O’Brien et al., 2000). The fluorescence was monitored at regular intervals of 1 h using a fluorescence plate reader (Perkin Elmer Enspire 2300) at 544 nmex/590 nmem. Similarly, Mitochondrial activity was assessed by incubation for 1 h of the mitochondrial-enriched fraction with the metabolic probe MTT as previously described (Franco et al., 2007) with same modifications. When viable, mitochondria convert the MTT to a colorful formazan, which can be detected at 550 nm. The values were normalized by protein concentration.
2.11 Determination of lipid peroxidation and DCF-DA oxidation
Lipid peroxidation end products were quantified as thiobarbituric acid reactive substances (TBARS) following the method of Ohkawa et al. (1979) with minor modifications. Briefly, groups of 20 flies from each treatment were homogenized in 1 mL mitochondrial isolation buffer and centrifuged at 1000g for 10 min (4 °C). After centrifugation, the supernatant was incubated in 0.45 M acetic acid/HCl buffer pH 3.4, 0.28% thiobarbituric acid, 1.2% SDS, at 95 °C for 60 min and absorbance then measured at 532 nm. The TBARS values were normalized by protein concentration. The results were expressed as % of control. We also quantified 2′,7′-dichlorofluorescein diacetate (DCFDA) oxidation as a general index of ROS production following Pérez-Severiano et al. (2004). The fluorescence emission of DCF resulting from DCF-DA oxidation was monitored at regular intervals at an excitation wavelength of 485 nm and an emission wavelength of 530 nm. The rate of DCF formation was calculated as a percentage of the DCF formation in relation to the sucrose-treated control group and values were normalized by protein concentration.
2.12 Quantitative real-time qRT-PCR and gene expression analysis
Approximately 1 μg of total RNA from 20 flies was extracted using the Trizol Reagent (Invitrogen) according to the manufacturer’s suggested protocol. After quantification, total RNA was treated with DNase I (DNAse I Amplification Grade – Invitrogen, NY) and cDNA was synthesized with iScript cDNA Synthesis Kit and random primers again according to the manufacturer’s suggested protocol (BIORAD). Quantitative real-time polymerase chain reaction was performed in 11 μL reaction volumes containing water treated with diethyl pyrocarbonate (DEPC), 200 ng of each primer (described in Table 1), and 0,2 × SYBR Green I (molecular probes) using a 7500 real time PCR system (Applied Biosystems, NY). The qPCR protocol was the following: activation of the reaction at 50 °C for 2 min, 95 °C for 2 min, followed by 40 cycles of 15 s at 95 °C, 60 s at 60 °C, and 30 s at 72 °C. All samples were analyzed as technical and biological triplicates with a negative control. Threshold and baselines were automatically determined, SYBR fluorescence was analyzed by 7500 software version 2.0.6 (Applied Biosystems, NY), and the CT (cycle threshold) value for each sample was calculated and reported using the 2−ΔΔCT method (Livak and Schmittgen, 2001). The GPDH gene was used as endogenous reference genes presenting no alteration in response to the treatment. For each well, analyzed in quadruplicates, a ΔCT value was obtained by subtracting the GPDH CT value from the CT value of the interest gene (sequences of tested genes are represented in Table 1). The ΔCT mean value obtained from the control group of each gene was used to calculate the ΔΔCT of the respective gene (2−ΔΔCT).
Gene
Primer sequences
GPDH
LEFT
5′ATGGAGATGATTCGCTTCGT
RIGHT
5′GCTCCTCAATGGTTTTTCCA
NRF2
LEFT
5′CGTGTTGTTACCCTCGGACT
RIGHT
5′AGCGCATCTCGAACAAGTTT
P38 MPK2a
LEFT
5′GGCCACATAGCCTGTCATCT
RIGHT
5′ACCAGATACTCCGTGGCTTG
ERK-rolled
LEFT
5′AATACGTTGCTACCCGATGG
RIGHT
5′ACGGTGAACCCAATACTCCA
JNK-like
LEFT
5′ATGGATATGGCCACGCTAAG
RIGHT
5′CTTTCTGTGCCTGGTGAACA
NFκB
LEFT
5′TGTGCTTTCTCTTGCCCTTT
RIGHT
5′CCGCAGAAACCAGAGAGTTC
HO-1
LEFT
5′AAACTAAGGCGCGTTTTCAA
RIGHT
5′GAGGGCCAGCTTCCTAAGAT
CAT
LEFT
5′ACCAGGGCATCAAGAATCTG
RIGHT
5′AACTTCTTGGCCTGCTCGTA
2.13 Statistical analysis
Statistical analysis was performed using a one- or two-way ANOVA followed by Tukey’s post hoc test. Differences were considered to be significant at the p < 0.05 level. All experiments were repeated 3–8 times per group (n = 3–8), depending on the experiment.
3 Results
3.1 HEPG antioxidant activity in vitro
Unpublished data from our research group (under consideration for publication elsewhere) revealed the presence of several phenolics and flavonoid compounds in the HEPG, including caffeic acid, ellagic acid, isoquercitrin and quercetin. The antioxidant activity of HEPG is directly related to its chemical composition, especially to the presence/concentrations of phenolic compounds. The total phenolic content was 32.2 mg of GAE/100 g HEPG. The ferric reducing antioxidant power (FRAP) of HEPG was tested, and the values obtained were 480 μM of Fe (II)/100 g of extract. In order to complement the evaluation of antioxidant activity of HEPG, the DPPH⋅ and ABTS⋅+ radical scavenging capacity was also tested. HEPG exhibited scavenging potential toward both radicals, and the mean AAE value determined in the ABTS assay (174.7 μM AAE/100 mg) was higher than the mean AAE determined in the DPPH assay (78 μM AAE/100 mg). These results are shown in Table 2. Data are expressed as mean ± SD.
DPPH
ABTS
Phenols
FRAP
(μM AAE/100 mg)
(μM AAE/100 mg)
(mg of GAEa/100 g)
(μM of Fe (II)/100 g)
HEPG
78.0 ± 5.7
174.7 ± 18.0
32.2 ± 2.8
480 ± 11.0
In order to evaluate the antioxidant and protective potential of HEPG in vitro, we incubated a D. melanogaster mitochondrial enriched fraction with TBOOH, an organic hydroperoxide, in the presence or absence of the plant extract. Then, ROS formation and mitochondrial activity were quantified. Incubation of flies mitochondria with TBOOH caused a significant increase in ROS as assessed by DCF-DA assay (Fig. 1A). Simultaneous incubation with HEPG completely inhibited ROS induction by TBOOH, demonstrating a high antioxidant capacity of HEPG against the oxidizing action of TBOOH (Fig. 1A). HEPG also showed significant ability to block the mitochondrial dysfunction caused by TBOOH when compared to control (Fig. 1B), indicating a protective potential to HEPG against oxidative stress in vitro.
HEPG in vitro antioxidant activity. Effects of HEPG on ROS formation (A) and mitochondrial activity. Mitochondria enriched fractions were incubated with TBOOH and HEPG for 1 h. Results are expressed as a percentage of control. Data are mean ± SEM; ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared to control; ### p < 0.001 compared to CP group.
3.2 In vivo experiments
Oxidative stress has been frequently attributed as a major mechanism during organophosphate compounds poisoning (Lukaszewicz-Hussain, 2010). However, the mechanisms by which organisms respond to oxidative stress elicited by OP compounds are not fully understood. For that reason, we performed a series of in vivo experiments in order to check for mechanisms of adaptive response of fruit flies against the deleterious effects caused by chlorpyrifos. Considering the important antioxidant and protective effects caused by HEPG, as described above and the fact that current therapies do not effectively block the pro-oxidative damage caused by OP intoxications, we also investigated whether HEPG would protect flies against the toxicity induced by CP in our experimental model.
For survival analysis, flies were exposed for 24 h to concentrations of 10, 20 and 50 mg/mL of HEPG alone or co-administered with CP 0.75 ppm. Exposure of flies to CP 0.75 ppm caused a significant decrease in the percentage of survived flies (p < 0.001) compared to the control. None of the tested HEPG concentrations caused significant changes in mortality compared to control, but when co-administered with CP 0.75 ppm the concentration of 50 mg/mL HEPG completely reversed the mortality of flies induced by CP (Fig. 2).
Effects of exposure to CP and HEPG on D. melanogaster survival. The survival rate was computed after flies were exposed to CP 0.75 ppm and 10, 20 and 50 mg/ml concentrations of HEPG for 24 h. Bars represent the mean ± SEM of experiments performed individually and are expressed as percentage of survived flies in relation to control group; ∗∗∗ p < 0.001 compared to control.
The locomotor activity of the flies was evaluated as a marker of CP induced toxicity. The collective negative geotaxis was evaluated by the number of flies able to attain the top of a marked tube. Under normal conditions, flies exhibit a tendency to climb a glass column. This natural behavior is called negative geotaxis. In this assay, a group of flies is challenged to climb up to a 6 cm mark in a glass tube. Control flies are expected to be positioned in the top of the tube after a certain amount of time. In a condition in which a locomotor deficit is present, flies are expected to be found at the bottom or at a lower position in the 6 cm marked tube. CP exposure caused a significant decrease in the percentage of flies on top (p < 0.05) compared to the control. Simultaneous treatment with HEPG was able to reverse the locomotor deficit (Fig. 3A). For a clear view, data obtained from flies exposed to CP and/or HEPG 50 mg/mL are depicted in Fig. 3B. The highest HEPG concentration tested was able to completely reverse (p < 0.001) locomotor deficits elicited by CP (Fig. 3B). Negative geotaxis was also evaluated in single flies. CP exposure caused a significant increase in the time taken by each fly to cross a 6 cm mark in a glass column (climbing time). Similarly, HEPG was able to reverse the locomotor deficit induced by CP (Fig. 3C). Based on the results obtained during mortality and locomotor assays, the concentration of 50 mg/mL HEPG was chosen for subsequent analysis.
Effects of exposure to CP and HEPG on locomotor performance in D. melanogaster. (A) Collective negative geotaxis after flies were treated with CP 0.75 ppm and 10, 20 and 50 mg/ml concentrations of HEPG for 24 h. (B) Negative geotaxis in flies treated with CP 0.75 ppm and 50 mg/ml of HEPG for 24 h. Individual negative geotaxis after flies were treated with CP 0,75 ppm and 10, 20 and 50 mg/ml concentrations of HEPG for 24 h, represents the time of climb of each fly. Data are means ± SEM; ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared to control; ## p < 0.01, ### p < 0.001 compared to CP group.
The acetylcholinesterase activity (AchE), a hallmark for OP poisoning, was measured. The enzyme activity was significantly inhibited (p < 0.01) in flies exposed to CP (≈25% decrease in AchE). As shown in Fig. 4, the co-exposure to the concentration of 50 mg/mL HEPG reversed this inhibition to the control level.
Acetylcholinesterase activity in flies exposed to CP and HEPG. The AchE activity was measured after flies were exposed to CP 0.75 ppm and HEPG 50 mg/ml for 24 h. Results are expressed as percentage of control (mean ± SEM); ∗∗ p < 0.01; ## p < 0.01 compared to CP group.
Exposure of flies to CP caused a significant loss of mitochondrial viability (p < 0.01) compared to the control. The simultaneous exposure to HEPG re-established mitochondrial activity to control levels (Resazurin assay- Fig. 5A; MTT assay-Fig. 5B). The production of reactive oxygen species (p < 0.05) and lipid peroxidation end products (p < 0.001) were significantly increased by CP. HEPG administration to flies significantly blocked both ROS and TBARS levels (Fig. 6A and B).
Mitochondrial activity in flies exposed to CP and HEPG. Resazurin reduction (A) and MTT reduction (B). Levels were determined in a mitochondrial enriched fraction prepared after flies were exposed to CP 0.75 ppm and HEPG 50 mg/ml for 24 h. Results are expressed as percentage of control (mean ± SEM); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared to control; ## p < 0.01, ### p < 0.001 compared to CP group.

Analysis of ROS production and lipid peroxidation in D. melanogaster exposed to CP and HEPG. Flies were exposed to CP 0.75 ppm and HEPG 50 mg/ml for 24 h. After treatments, flies were homogenized and a mitochondrial enriched supernatant was used for analysis of DCF-DA fluorescence as an index of ROS production (A) and lipid peroxidation by TBARS assay (B). Results are expressed as percentage of control (mean ± SEM); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared to control; # p < 0.05, ### p < 0.001 compared to CP group.
Non-protein thiols (NPSH) content, which consists mainly in GSH, was significantly increased in flies exposed to CP (p < 0.01) and compared with the control, the co-exposure with HEPG restored GSH levels (Fig. 7A), while protein thiols (PSH) were not changed (Fig. 7B).
Effects of exposure to CP and HEPG on thiol status in D. melanogaster. Flies were exposed to CP 0.75 ppm and HEPG 50 mg/ml for 24 h. After treatment was finished non-protein thiols (NPSH) (A) and protein thiols (PSH) (B) were determined. Results are expressed as percentage of control (mean ± SEM); ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared to control; ### p < 0.001 compared to CP group.
The activity of three major antioxidant enzymes known to be modulated under oxidative stress conditions was measured. Glutathione S-transferase, a group of enzymes involved in detoxification of xenobiotics was significantly increased after exposure to CP (p < 0.001). Treatment of flies with HEPG was able to reverse the GST activity to control levels (Fig. 8A). The activity of superoxide dismutase (p = 0.4468) and catalase (p = 0.6538) had no significant changes in their activities (Fig. 8B and C, respectively).
Antioxidant enzyme activity in flies exposed to CP and HEPG. Flies were exposed to CP 0.75 ppm and HEPG 50 mg/ml for 24 h. After treatment was finished, glutathione s-transferase (GST) (A), Catalase (CAT) (B) and superoxide dismutase (SOD) (C) were determined. Results are expressed as percentage of control (mean ± SEM); ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared to control; ## p < 0.01 compared to CP group.
We evaluated the expression of genes involved in cellular stress response in flies exposed to CP for 24 h in the presence/absence of the HEPG concentration of 50 mg/mL. qRT-PCR analysis revealed a significant increase in gene expression of NF-E2-related factor 2 (NRF2) in flies exposed to CP (p < 0.001). This effect was blocked in the presence of HEPG 50 mg/mL (p < 0.05) when compared to the control group (Fig. 9A). MPK2 (which encodes D. melanogaster p38MAPK) also presented an increased expression in flies exposed to CP (p < 0.01). HEPG was also able to reverse this increase to control levels (Fig. 9B).
Quantitative real time PCR (qRT-PCR) analysis of Nrf2 and p38MAPK mRNA in flies exposed to CP and HEPG. Flies were exposed to CP 0.75 ppm and HEPG 50 mg/ml for 24 h. qRT-PCR was used to quantify levels of mRNA, relative to respective controls, after exposure. The data were normalized against GPDH transcript levels. Results are expressed as percentage of control (mean ± SEM); ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 compared to control; # p < 0.05, ## p < 0.01,### p < 0.001 compared to CP group.
The mRNA expression of ERK-rolled, JNK, HO-1, NFKB and CAT showed no significant changes (data not shown).
4 Discussion
Oxidative stress has been extensively implicated as a major factor in the toxicity induced by organophosphate compounds (OP) (dos Santos et al., 2011; Nurulain et al., 2013; Čolovićet al., 2015). Studies have concluded that antioxidants can be used as an adjunct therapy during OP poisoning (Nurulain et al., 2013). However, the mechanisms by which organisms respond to oxidative stress induced by OP and the actual effectiveness of antioxidants against OP poisoning are still unclear. Improving the knowledge on the biochemical and molecular responses elicited by both OP and antioxidant compounds in complex organisms would improve the understanding of their mode of action, thus, opening novel therapeutic possibilities. Thereby, studies are necessary in order to elucidate such important questions.
Plant extracts have been used as a source of medicines for a wide variety of human illnesses and toxicological conditions. Herbal and natural products have recently received increased attention because of their biological and pharmacological activities (Amirghofran, 2012). P. guajava is a plant of popular use in different countries and has been described for various medicinal properties (Gutiérrez et al., 2008).
D. melanogaster has emerged as one of the most suitable organisms to study human disease and toxicological condition (Siddique et al., 2005). It has been used not only because natural populations of flies are resistant to toxins released by humans into the environment, but also due to the advantages arising from its biological cycle, as the rapid development and easy handling. Another advantage relies on the fly genome, which is completely characterized and the absence of cellular mitosis in flies adulthood, resulting in synchronized aging of its cells (Jimenez-Del-Rio et al., 2009). Therefore, D. melanogaster is a convenient animal model for answering questions such as how organisms defend themselves against certain pollutants, including organophosphate intoxication mechanisms, since many aspects of homeostasis are conserved between flies and human (Yepiskoposyan et al., 2006).
In this study HEPG antioxidant potential was evaluated by their ability to scavenge free radicals such as ABTS and DPPH, expressed equivalently to the known antioxidant, ascorbic acid. The DPPH radical has been widely used to test the free radical scavenging ability of various natural products and has been accepted as a model compound for free radicals originating in lipids (Porto et al., 2000). The ABTS assay is an excellent method used for determining the antioxidant activity of a broad diversity of substances, such as hydrogen-donating antioxidants or scavengers of aqueous phase radicals and of chain breaking antioxidants or scavengers of lipid peroxyl radicals (Re et al., 1999). The average values of AAE determined in the assay ABTS were higher than those observed in the DPPH test (174.7 ± 18.0–78.0 ± 5.7, respectively), since DPPH reacts preferentially with lipophilic antioxidants while the ABTS reacts with both lipophilic and hydrophilic antioxidants (Prior et al., 2005). The antioxidant capacity of HEPG was also demonstrated by its significant iron reducing power (measured by FRAP assay). The iron reducing power property of HEPG indicates that the antioxidant compounds in its constitution are electron donors and can reduce oxidized intermediates during processes such as lipid peroxidation, so they can act as primary and secondary antioxidants (Yen and Chen, 1995). HEPG also showed a significant amount of phenolics. Determination of total phenolics is one of the important parameters to estimate the amount of antioxidants. Phenolics constitute a major group of compounds acting as primary antioxidants or free radical scavengers (Kancheva and Kasaikina, 2013).
The antioxidant ability of HEPG was correlated to its protective effects against tert-butyl hydroperoxide (TBOOH)-induced mitochondrial dysfunction and ROS production. The HEPG was effective in blocking the loss of viability and ROS production elicited by the hydroperoxide in vitro, thus confirming its antioxidant potential. The antioxidant potential of HEPG can be attributed to its major constituents. An unpublished study by our research group determined the major compounds of HEPG to be caffeic acid > ellagic acid > isoquercitrin > quercetin (unpublished data). Previous studies also reported the antioxidant potential in several P. guajava fractions and structures (Gutiérrez et al., 2008; Verma et al. 2013; Flores et al., 2014; Feng et al., 2015).
The increase in agricultural practices has led to indiscriminate use of agrochemicals and pesticides, which causes damage both to the environment and to human health. Chlorpyrifos (CP) is an organophosphate pesticide widely used due to its lower persistence in the environment (Soltaninejad and Shadnia, 2014). CP is known to cause neurological damage via inhibition of acetylcholinesterase enzyme and oxidative stress mechanisms (Yu et al., 2008; Goel et al., 2005). Current available treatments for CP poisoning are based primarily on the use of atropine, a symptomatic antidote and, less frequently, oximes, which are cholinesterase reactivators (Peter et al., 2014). However, whether such therapies are able to reverse the secondary damages caused by CP is unclear.
Here we show that exposure of D. melanogaster to CP, at a concentration of 0.75 ppm for 24 h was able to induce mortality, severe locomotor damage and inhibition of acetylcholinesterase activity. The decrease in locomotor activity as a result of inhibition of cholinesterase is well reported in the literature (Moser, 2000; Nostrandt et al., 1997; Timofeeva and Gordon, 2002). AChE is responsible for the hydrolysis of the neurotransmitter acetylcholine necessary for cholinergic synaptic activity. Inhibition of AChE promotes accumulation of acetylcholine in the synaptic cleft, which results in a cholinergic overstimulation at both CNS and motor plate levels (Chakraborty et al., 2009; Xia et al., 2014). The inhibition of locomotor activity in flies exposed to the CP shown here suggests that inhibition of AChE enzyme can be related to the neurobehavioral changes noticed. The locomotor damage caused by CP has been reported in several species, including aquatic organisms (Kavitha and Rao, 2008; Yen et al., 2011; Tilton et al., 2011; Richendrfer et al., 2012). Flies treated with HEPG showed improvement in locomotor deficits caused by CP and the AChE activity was completely restored, indicating a link between AChE inhibition and the locomotor impairment induced by CP in our model. The exact mechanisms by which HEPG restored AchE activity need further elucidation.
The CP ability to generate reactive oxygen species (ROS), lipid peroxidation and loss of cell viability in adult flies was also assessed. A previous report (Gupta et al., 2010) has shown a positive correlation between the ROS generation, lipid peroxidation, apoptosis and cell damage in 3rd instar D. melanogaster larva exposed to CP. Here we have shown that in parallel to ROS and lipid peroxidation induction, the exposure of adult flies to CP was able to affect cell viability, measured as a general index of mitochondrial activity. In a previous study, isolated lymphocytes incubated for 72 h with CP showed a significant decrease in viability and increase in lipid peroxidation (Navaei-Nigjeh et al., 2015). Chlorpyrifos was also able to cause a concentration-dependent reduction in cell viability in HeLa cells, HEK293 and S2 D. melanogaster cells (Li et al., 2015). Altogether, these results converge to demonstrate a link between oxidative stress and cell damage after exposure to CP. Co-treatment of flies with HEPG was able to reverse both ROS and lipid peroxidation, resulting in fully restored cell viability.
In order to cope with oxidative stress, organisms are constituted of a highly specialized molecular defense system aiming at shielding cells against the deleterious effects of ROS and xenobiotics (Halliwell and Gutteridge, 2007). Antioxidants can be synthesized by cells (e.g., reduced glutathione (GSH), superoxide dismutase (SOD), and catalase (CAT), or taken from the diet (Kasote et al., 2015). GSH is essential for the normal maintenance of cellular redox status. The most important physiological functions of GSH involve scavenging of free radicals, H2O2 and other peroxides. GSH is also involved in maintaining the –SH groups of proteins, enzymes, and other molecules in reduced form (Srikanth et al., 2013). The glutathione S-transferases (GST) are a superfamily of enzymes that catalyze the conjugation of sulfhydryl groups from GSH with electrophilic groups of xenobiotics in order to make them less reactive and facilitate the excretion of the cell (Yamuna et al., 2012). The involvement of GST in the cell response to OP compounds, including CP has been recently reported (Singh et al., 2006; Khalil, 2015). In our study, flies GST activity and GSH levels were increased after exposure to CP. Considering the key role of both GST and GSH in the detoxification of xenobiotics, one could suppose that higher levels of these antioxidants are a result of an adaptive response toward elimination of CP and its metabolites in exposed flies. Likewise, administration of HEPG resulted in restoration of GST activity and GSH content to control levels. The protective role of P. guajava was previously evaluated in rats exposed to arsenic, where the treatment with the aqueous extract of P. guajava (100 mg/kg body weight) significantly restored oxidative stress markers such as lipid peroxidation, GSH content and activities of SOD and CAT enzymes (Tandon et al., 2012).
The antioxidant response to oxidative stress involves several signaling pathways, including the NRF2-ARE, that regulates the expression of a variety of enzymes by binding of the transcription factor NRF2 to DNA at the ARE element (antioxidant response element) (Chen et al., 2015). Under normal conditions the NRF2 is located in the cytoplasm forming an inactive complex with the Keap-1 protein that suppresses transcriptional activity of NRF2. Exposure to stressors such as ROS promotes the release of NRF2 from its suppressor Keap-1 allowing its translocation to the nucleus where the interaction occurs with the ARE, activating the transcription of antioxidant enzymes and phase II detoxification (GST, GPX, SOD, TRX and others) involved in the metabolism of xenobiotics electrophilic groups (Osbrurn and Kensler, 2008). The NRF2 signaling pathway has been described as major pathway of oxidative stress and cellular damage regulation. (Zhang, 2006; Kobayashi and Yamamoto, 2006; Copple et al., 2008). It has been studied in both mammalian systems as well as in invertebrates, including D. melanogaster and Caenorhabditis elegans (Pitoniak and Bohmann, 2015). The GST enzymes and GSH synthesis are regulated by the NRF2 pathway. Here we showed that in parallel to GST and GSH increases, CP was able to significantly increase the expression of NRF2 gene, pointing to a link between NRF2 activation and a positive modulation of GST-GSH detoxifying pathways in flies exposed to CP. Similar results were observed in JEG-3 cells, where CP significantly increased the levels of mRNA and protein NRF2 (Chiapella et al., 2013).
The nuclear translocation of NRF2 often requires the activation of signal transduction pathways, including the mitogen-activated protein kinases (MAPKs) (Shen et al., 2004). The MAPK family includes the extracellular activated protein kinase (ERK 1/2), c-Jun N-terminal kinase (JNK1/2), and 38 kDa protein kinase (p38MAPK), proteins whose function and regulation are well conserved from unicellular to complex organisms (Paula et al., 2012). Models in vitro and in vivo have shown that the regulatory extracellular ERK and p38MAPK modulate the expression of antioxidant enzymes for the activation of NRF2 (Sun et al., 2008; Chen et al., 2015). Activation of these kinases may occur in response to hyperosmotic stress, cytokine exposure, and toxic injury, including stress oxidative (Paula et al., 2012). In addition to the observed increase in the expression of NRF2, the D. melanogaster gene (MPK2) was also significantly increased in CP exposed flies. In a previous study, exposure of human neuroblastoma SH-SY5Y cells to CP promoted activation of the p38MAPK pathway in a ROS dependent manner, suggesting p38MAPK as a critical mediator of neuronal apoptosis induced by CP (Ki et al., 2013). Oxidative stress can act directly on the NRF2-Keap-1 complex or alternatively, via activation of protein kinases (P13 K, p38, ERK, PKC, JNK) causing phosphorylation and subsequent release of NRF2 from its inhibitory protein (Son et al., 2008). Exposure of flies to HEPG abolished the effects of CP toward NRF2 and p38MAPK in adult D. melanogaster.
In this study we have shown that the CP at 0.75 ppm was able to cause severe damage in adult D. melanogaster treated for 24 h with the pesticide, including increased mortality, locomotor deficits, inhibition of acetylcholinesterase, ROS production, decreased cell viability and changes in antioxidant defense systems. Based on the results obtained here, it is possible to point for a role of NRF2 and p38MAPK pathways in the cell response to oxidative stress induced by CP (Scheme 1). We also suggest that oxidative stress generated by the CP may act in two ways, either by direct dissociation of NRF2-Keap1 complex or by activation of MAPK pathways by increased expression of p38MAPK which in turn phosphorylates NRF2 promoting the translocation of NRF2 to core, where it initiates a positive modulation of phase II antioxidant pathways. As a result of this potential event, we observed GST activity and GSH levels to be increased in D. melanogaster exposed to CP.
Potential mechanisms involved during CP exposure of adult Drosophila melanogaster and the protective effects of HEPG. Based on the results, CP induces ROS, which in turn leads to several deleterious effects (as demonstrated in the results section). As a response to CP induced oxidative stress, NRF2 protein is dissociated from its inhibitory protein Keap1 via a direct action of ROS on NRF2 containing thiol groups or via a potential phosphorylation by p38MAPK. The subsequent migration of NRF2 to the nuclei initiates transcription of ROS/xenobiotics detoxifying pathways, which may involve both GST and GSH.
Taken together, our results clearly showed, for the first time, that HEPG had high antioxidant capability and displayed a highly protective effect against toxicity induced by CP in D. melanogaster, suggesting P. guajava as an alternative adjunct treatment for organophosphate compound poisoning.
Acknowledgments
Authors acknowledge CNPq (482313/2013-7; 456207/2014-7), FAPERGS (19542551/13-7; 23802551/14-8) and Unipampa for financial support. JLF is a CNPq research fellowship recipient.
References
- Herbal medicines for immunosuppression. Iran J. Allergy Asthma Immunol.. 2012;11:111-119.
- [Google Scholar]
- Vascular aging: chronic oxidative stress and impairment of redox signaling-consequences for vascular homeostasis and disease. Annals Med.. 2013;45:17-36.
- [Google Scholar]
- Locomotor and geotactic behavior of Drosophila melanogaster over-expressing neprilysin 2. Peptides. 2009;30:571-574.
- [Google Scholar]
- A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem.. 1976;7:248-254.
- [Google Scholar]
- Evaluation of the developmental and reproductive toxicity of chlorpyrifos in the rat. Fundam. Appl. Toxicol.. 1996;29:119-130.
- [Google Scholar]
- Chronic exposures to cholinesterase-inhibiting pesticides adversely affect respiratory health of agricultural workers in India. J. Occup. Health.. 2009;51:488-497.
- [Google Scholar]
- The role of Nrf2 in oxidative stress induced endothelial injuries. J. Endocrinol.. 2015;225:83-99.
- [Google Scholar]
- The organophosphate chlorpyrifos disturbs redox balance and triggers antioxidant defense mechanisms in JEG-3 cells. Placenta. 2013;34:792-798.
- [Google Scholar]
- The Nrf2-Keap1 defence pathway: role in protection against drug-induced toxicity. Toxicology. 2008;246:24-33.
- [Google Scholar]
- Chronic exposure to rotenone models sporadic Parkinson’s disease in Drosophila melanogaster. J. Neurosci.. 2004;24:10993-10998.
- [Google Scholar]
- In vitro evaluation of neurotoxicity potential and oxidative stress responses of diazinon and its degradation products in rat brain synaptosomes. Toxicol. Lett.. 2015;233(1):29-37.
- [Google Scholar]
- A study on the quality and identity of Brazilian pampa biome honey: evidences for its beneficial effects against oxidative stress and Hyperglycemia. Int. J. Food Sci.. 2014;2014(ID 470214):1-11.
- [Google Scholar]
- Analysis of antidiarrhoeic effect of plants used in popular medicine. Revista de Saúde Pública. 1995;29:56-59.
- [Google Scholar]
- Effects of K074 and pralidoxime on antioxidant and acetylcholinesterase response in malathion-poisoned mice. Neurotoxicology. 2011;32(6):888-895.
- [Google Scholar]
- A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol.. 1961;7:88-95.
- [Google Scholar]
- Cytotoxic and antioxidant constituents from the leaves of Psidium guajava. Bioorg. Med. Chem. Lett.. 2015;25(10):2193-2198.
- [Google Scholar]
- Chemical composition and antioxidant activity of seven cultivars of guava (Psidium guajava) fruits. Food Chem.. 2015;170:327-335.
- [Google Scholar]
- Mercurial-induced hydrogen peroxide generation in mouse brain mitochondria: protective effects of quercetin. Chem. Res. Toxicol.. 2007;20:1919-1926.
- [Google Scholar]
- Antioxidant status and stress proteins in the gills of the brown mussel Pernaperna exposed to zinc. ChemBiol. Interact.. 2006;160:232-240.
- [Google Scholar]
- Protective effects of zinc on lipid peroxidation, antioxidant enzymes and hepatic histoarchitecture in chlorpyr- ifos-induced toxicity. Chem. Biol. Interact.. 2005;156:131-140.
- [Google Scholar]
- Chlorpyrifos induces apoptosis and DNA damage in Drosophila through generation of reactive oxygen species. Ecotoxicol. Environ. Saf.. 2010;73(6):1415-1423.
- [Google Scholar]
- Psidium guajava: a review of its traditional uses, phytochemistry and pharmacology. J. Ethnopharmacol.. 2008;117(1):1-27.
- [Google Scholar]
- Assays for differentiation of glutathione S transferases. Meth. Enzymol.. 1981;77:398-405.
- [Google Scholar]
- Free Radicals in Biology and Medicine (fourth ed.). New York: Oxford University Impress; 2007. p. 936
- Low level of exposure to pesticides leads to lung dysfunction in occupationally exposed subjects. InhalToxicol. 2008;20(9):839-849.
- [Google Scholar]
- Screening of some plants used in the Brazilian folk medicine for the treatment of infectious diseases. Memórias do Instituto Oswaldo Cruz. 2002;97:1027-1031.
- [Google Scholar]
- The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay”. Anal. Biochem.. 1996;239:70-76.
- [Google Scholar]
- In vitro and in vivo effects of chlorpyrifos on glutathione peroxidase and catalase in developing rat brain. Neurotoxicology. 2000;21:141-145.
- [Google Scholar]
- Guava fruit (Psidium guajava) as a new source of antioxidant dietary fiber. J. Agric. Food Chem.. 2001;49:5489-5493.
- [Google Scholar]
- the effects of polyphenols on survival and locomotor activity in Drosophila melanogaster exposed to iron and paraquat. Neurochem. Res.. 2009;35(2):227-238.
- [Google Scholar]
- Bio-antioxidants – a chemical base of their antioxidant activity and beneficial effect on human health. Curr. Med. Chem.. 2013;20(37):4784-4805.
- [Google Scholar]
- Significance of antioxidant potential of plants and its relevance to therapeutic application. Int. J. Biol. Sci.. 2015;11(8):982-991.
- [Google Scholar]
- Toxic effects of chlorpyrifos on antioxidant enzymes and target enzyme acetylcholinesterase interaction in mosquito fish Gambusia affinis. Environ. Toxicol. Pharmacol.. 2008;26:192-198.
- [Google Scholar]
- Toxicological effects and oxidative stress responses in freshwater snail, Lanistes carinatus, following exposure to chlorpyrifos. Ecotoxicol. Environ. Saf.. 2015;116:137-142.
- [Google Scholar]
- JNK and p38 MAPK regulate oxidative stress and the inflammatory response in chlorpyrifos-induced apoptosis. Toxicol. Lett.. 2013;218(3):235-245.
- [Google Scholar]
- Nrf2-Keap1 regulation of cellular defense mechanisms against electrophiles and reactive oxygen species. Adv. Enzyme. Regul.. 2006;46:113-140.
- [Google Scholar]
- Superoxide-driven oxidation of quercetin and a simple sensitive assay for determination of superoxidedismutase. Biochem. Int.. 1989;19:1117-1124.
- [Google Scholar]
- The organophosphate insecticide chlorpyrifos confers its genotoxic effects by inducing DNA damage and cell apoptosis. Chemosphere. 2015;135:387-393.
- [Google Scholar]
- Mutations in acetylcholinesterase associated with insecticide resistance in the cotton aphid Aphis gossypii Glover. Insect Biochem. Mol. Biol.. 2004;34:397-405.
- [Google Scholar]
- Analysis of relative gene expression data using real-time quantitative PCR and the 2(2Delta Delta C(T)) method. Methods. 2001;25:402-408.
- [Google Scholar]
- Role of oxidative stress in organophosphate insecticide toxicity–Short review. Pest. Biochem. Physiol.. 2010;98:145-150.
- [Google Scholar]
- Dose-response and time-course of neurobehavioral changes following oral chlorpyrifos in rats of different ages. Neurotoxicol. Teratol.. 2000;22:713-723.
- [Google Scholar]
- In vitro protection of human lymphocytes from toxic effects of chlorpyrifos by selenium-enriched medicines. Iran J. Basic, Med. Sci.. 2015;18(3):284-291.
- [Google Scholar]
- The relationship of oral chlorpyrifos effects on behavior, acetylcholinesterase inhibition, and muscarinic receptor density in rat. Pharmacol. Biochem. Behav.. 1997;58:15-23.
- [Google Scholar]
- Antioxidants in organophosphorus compounds poisoning. Arh. Hig. Roda. Toksikol.. 2013;64(1):169-177.
- [Google Scholar]
- Investigation of the Alamar Blue (resazurin) fluorescent dye for the assessment of mammalian cell cytotoxicity. Eur. J. Biochem.. 2000;267(17):5421-5426.
- [Google Scholar]
- Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem.. 1979;95:351-358.
- [Google Scholar]
- Nrf2 signaling: an adaptive response pathway for protection against environmental toxic insults. Mutat. Res.. 2008;659(1–2):31-39.
- [Google Scholar]
- Effects of Hg(II) exposure on MAPK phosphorylation and antioxidant system in D. melanogaster. Environ. Toxicol.. 2012;29(6):621-630.
- [Google Scholar]
- S-Allylcysteine, a garlic-derived antioxidant, ameliorates quinolinic acid-induced neurotoxicity and oxidative damage in rats. Neurochem. Int.. 2004;45:1175-1183.
- [Google Scholar]
- Clinical features of organophosphate poisoning: a review of different classification systems and approaches. Indian J. Crit. Care Med.. 2014;18(11):735-745.
- [Google Scholar]
- Antioxidant properties and phenolic content of different floral origin honeys. J. ApiProduct ApiMedical Sci.. 2009;1:43-50.
- [Google Scholar]
- Mechanisms and functions of Nrf2 signaling in Drosophila. Free Radic. Biol. Med.. 2015;15:288-290.
- [Google Scholar]
- Antiradical properties of commercial cognacs assessed by the DPPH• test. J. Agric. Food Chem.. 2000;48:4241-4245.
- [Google Scholar]
- Standardized methods for the determinations of antioxidant capacity and phenolics in foods and dietary supplements. J. Agric. Food Chem.. 2005;53:4290-4302.
- [Google Scholar]
- Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Radic. Biol. Med.. 1999;26:1231-1237.
- [Google Scholar]
- Developmental subchronic exposure to chlorpyrifos reduces anxiety-related behavior in zebrafish larvae. Neurotoxicol. Teratol.. 2012;34:458-465.
- [Google Scholar]
- Regulation of Nrf2 transactivation domain activity. The differential effects of mitogen-activated protein kinase cascades and synergistic stimulatory effect of Raf and CREB-binding protein. J. Biol. Chem.. 2004;279(22):23052-23060.
- [Google Scholar]
- Genotoxicity of industrial solid waste leachates in Drosophila melanogaster. Environ. Mol. Mutagenesis.. 2005;46:189-197.
- [Google Scholar]
- Erythrocyte antioxidant enzymes in toxicological evaluation of commonly used organophosphate pesticides. Indian J. Exp. Biol.. 2006;44(7):580-583.
- [Google Scholar]
- Abdollahi M., Balali Mood M., eds. History of the Use and Epidemiology of Organophosphorus Poisoning, in Basic and Clinical Toxicology of Organophosphorus Compounds. London, UK: Springer Science & Business Media; 2014. p. :25-44.
- Glutathione and its dependent enzymes’ modulatory responses to toxic metals and metalloids in fish-a review. Environ. Sci. Pollut. Res. Int.. 2013;20(4):2133-2149.
- [Google Scholar]
- Phosphorylation of Nrf2 at multiple sites by MAP has a limited contribution in modulating the Nrf2-dependent antioxidant response. PLoS One. 2009;4(8):e6588.
- [Google Scholar]
- Protective Effect of Psidium guajava in Arsenic-induced oxidative stress and cytological damage in rats. Toxicol. Int.. 2012;19(3):245-249.
- [Google Scholar]
- Swimming impairment and acetylcholinesterase inhibition in zebrafish exposed to copper or chlorpyrifos separately or as mixtures. Comp. Biochem. Physiol. C Toxicol. Pharmacol.. 2011;153:9-16.
- [Google Scholar]
- EEG spectra, behavioral states and motor activity in rats exposed to acetylcholinesterase inhibitor chlorpyrifos. Pharmacol. Biochem. Behav.. 2002;72:669-679.
- [Google Scholar]
- Radical scavenging activity of different floral origin honey and beebread phenolic extracts. Food Chem.. 2007;101:502-514.
- [Google Scholar]
- Guava (Psidium guajava L.) Powder as an Antioxidant Dietary Fibre in Sheep Meat Nuggets. Asian-Australas. J. Anim. Sci.. 2013;26(6):886-895.
- [Google Scholar]
- Quercitrin, a glycoside form of quercetin, prevents lipid peroxidation in vitro. Brain Res.. 2006;1107:192-198.
- [Google Scholar]
- Flavonoids: antioxidants or signalling molecules? Free Radic. Biol. Med.. 2004;36:838-849.
- [Google Scholar]
- Nanomaterials-based optical techniques for the detection of acetylcholinesterase and pesticides. Sensors (Basel).. 2014;15(1):499-514.
- [Google Scholar]
- Glutathione Stransferase and metallothionein levels in the freshwater prawn Macrobrachiummalcolmsonii exposed to mercury. J. Environ. Biol.. 2012;33:133-137.
- [Google Scholar]
- Antioxidant activity of various tea extracts in relation to their antimutagenicity. J. Agric. Food Chem.. 1995;43:27-32.
- [Google Scholar]
- Differential acetylcholinesterase inhibition of chlorpyrifos diazinon and parathion in larval zebrafish. Neurotoxicol. Teratol.. 2011;33:735-741.
- [Google Scholar]
- Transcriptome response to heavy metal stress in Drosophila reveals a new zinc transporter that confers resistance to zinc. Nucl. Acids Res.. 2006;34(17):4866-4877.
- [Google Scholar]
- Apoptotic effect of organophosphorous insecticide chlorpyrifos on mouse retina in vivo via oxidative stress and protection of combination of vitamins C and E. Exp. Toxicol. Pathol.. 2008;59:415-423.
- [Google Scholar]
- Oxidative stress response and Nrf2 signaling in aging. Free Radic. Biol. Med.. 2015;5849(15) 00259-2
- [Google Scholar]
- Mechanistic studies of the Nrf2-Keap1 signaling pathway. Drug Metab. Rev.. 2006;38(4):769-789.
- [Google Scholar]
