5.2
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
5.3
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
View/Download PDF

Translate this page into:

Original article
08 2022
:15;
104013
doi:
10.1016/j.arabjc.2022.104013

Asparagus racemosus mediated silver chloride nanoparticles induce apoptosis in glioblastoma stem cells in vitro and inhibit Ehrlich ascites carcinoma cells growth in vivo

Department of Biochemistry and Molecular Biology, Faculty of Science, University of Rajshahi, Rajshahi 6205, Bangladesh
Department of Pharmacy, Faculty of Science, University of Rajshahi, Rajshahi 6205, Bangladesh

⁎Corresponding author. rashelkabir@ru.ac.bd (Syed Rashel Kabir)

Disclaimer:
This article was originally published by Elsevier and was migrated to Scientific Scholar after the change of Publisher.

Peer review under responsibility of King Saud University.

Abstract

Glioblastoma multiforme (GBM) is a type of brain tumor that is most aggressive, proliferates rapidly and intensive invasion is governed by cell migration and destruction of the extracellular matrix. In the present study, we evaluated the antiproliferative efficacy of the synthesized silver chloride nanoparticles (AgCl-NPs) from Asparagus racemosus root extract against human glioblastoma stem cells (GSCs) and Ehrlich ascites carcinoma (EAC) cells. Biosynthesis of A. racemosus-AgCl-NPs was confirmed by color change, UV–visible spectroscopy and characterized by transmitted electron microscope, energy dispersive spectroscopy, x-ray powder diffraction and Fourier-transform infrared spectroscopy. The A. racemosus-AgCl-NPs inhibited GSCs and EAC cells growth with the IC50 values of 4.8 and 4.69 µg/ml, respectively. A. racemosus-AgCl-NPs induced apoptosis in GSCs which was confirmed by annexin V/PI assay, various genes expression, and caspase-3 protein expression as detected by the immunofluorometric assay. The expression level of the TLR9, NFκB, TNFα, p21 and IKK genes were increased consequently with the decrease of PARP, EGFR, NOTCH2, mTOR and STAT3 genes in GSCs as examined by real-time PCR. The cell cycle arrest at G0/G1 phase was detected by flow cytometry. In addition, A. racemosus-AgCl-NPs caused significant inhibition of EAC cells growth, reduced tumor burden, increased the survival of EAC-bearing mice and restored the hematological parameters when compared with the control mice. The synthesized AgCl-NPs inhibited the proliferation of GSCs in vitro with the induction of apoptosis and inhibited the growth of EAC cells in vivo in mice by reducing the tumor burden and increasing the survival periods.

Keywords

Apoptosis
Gene expression
Cell cycle
Cancer prevention
Cancer stem cells
EAC cells
1

1 Introduction

Glioblastoma multiforme (GBM) is the most frequent and the most aggressive grade IV malignant type of primary brain tumor in adults (Ostrom et al., 2015; Roosen et al., 1989). Hallmarks of this aggressive cancer include a heterogeneous mixture of low differentiated neoplastic astrocytes in early-stage and extensive infiltration, as well as strong vascular proliferation into the brain parenchymal niches (Huang et al., 2017; Lee et al., 2017). Over the past decade, thousands of articles reported on the prognosis, treatment response and treatment target of glioblastoma (Ozdemir-Kaynak et al., 2018; Wei et al., 2014). However, till now, for controlling the disease, no remarkable therapeutic options and useful treatments have been referred (Huang et al., 2017; Lee et al., 2017). Thus, a translational new approach is essential for the treatment of these patients.

Nanotechnology-based drug delivery can be one of the emerging and promising techniques (Thuy et al., 2015). Researchers are trying to use metal nanoparticles in the pharmaceutical and biomedical areas as alternative antimicrobial & anticancer agents (Asaduzzaman et al., 2016; Aygün et al., 2020; Baghbani-Arani et al., 2017; Kabir et al., 2020a). The most impressive nanoparticles (NPs) were made from noble metals, particularly silver, gold and platinum. Among them, silver has been attracted due to its tremendous medicinal value to culinary items e.g., disinfection and showing enormous anticancer efficiency. Although several synthesizing techniques are available in nanotechnology-based drug delivery, the biogenic silver-NPs achieved great attention due to their eco-friendliness and the usage of natural resources. Biomolecules that are available in plants, interact with the silver and thereby serve as reducing & capping agents (Ahmed et al., 2016). Recently, researchers found herbal extract-mediated synthesized silver nanoparticles retained potent antiproliferative effects against cancer cells (Antony et al., 2013; Barabadi et al., 2019a; Barua et al., 2013; Firdhouse and Lalitha, 2013; Kabir et al., 2020a, 2020b). The genotoxicity of some biogenic nanoparticles is highly dependent on the biological source, synthesis parameters, applied assay, etc. that varies case-by-case (Barabadi et al., 2019b). Recently, several times higher toxicity of the biogenic silver nanoparticles was reported in cancer cells than normal cells and few of them did not exert any toxicity against the normal cells (Barabadi et al., 2019a, 2018). Recently, we have synthesized Ag/AgCl-NPs from Geodorum densiflorum rhizome, Zizyphus mauritiana fruit extract and Kaempferia rotunda tuberous rhizome extracts that exerted toxic effects against the human glioblastoma stem cancer cells (GSCs), breast cancer cells (MCF-7), human pancreatic cancer cells (BxPC-3) and Ehrlich ascites carcinoma (EAC) cells (Kabir et al., 2020a, 2020b, 2022). In search of the most effective biogenic silver nanoparticles, roots of the Asparagus racemosus Wild (family Asparagaceae) were used in the present study and tested against GSCs and EAC cells.

A. recemosus, locally known as ‘Satomuli’ is commonly used in the ‘Ayurvedic medicine’ due to its several beneficiary effects. The plant extract is used for the treatment of several diseases and many bio-active compounds (shatavarin IV, lectin, sarsapogenin and diosgenin-derived steroidal constituents) those shown anticancer activities against different cancer cells in vitro and in vivo were isolated from the root (Bhutani et al., 2018; Kabir et al., 2021; Mitra et al., 2012). However, the anticancer activity of A. racemosus or its derivative nanoparticles against glioblastoma stem cells and EAC cells has never been reported. Therefore, in this manuscript, AgCl-NPs were synthesized from the root extract of A. racemosus and characterized using different techniques. Finally, antiproliferative mechanisms were elucidated against GSCs in vitro and EAC cells in vivo in mice.

2

2 Materials and methods

2.1

2.1 Chemicals and reagents

The chemicals which were used were purchased from world-leading companies e.g. Gibco, Promega, Amresco, Life technology, Applied biosystem, etc.

2.2

2.2 Sample preparation

A. racemosus roots were purchased from the medicinal village, Natore district, Bangladesh. Around 300 g of the A. racemosus roots were washed with deionized water and homogenized with 1 L of 10 mM of Tris-HCl. The homogenate was centrifuged at 10,000g for 30 min at 4 °C and the clear supernatant was collected for the synthesis of silver nanoparticles.

2.3

2.3 Silver chloride nanoparticles synthesis

To find out the best condition of the synthesis of nanoparticles, 2 ml of supernatant was taken to each of the four test tubes and 0.5 M of AgNO3 solution was mixed with supernatant of each test tube to reach the final concentration of 1, 2, 3 and 4 mM, and kept under sunlight for 2 h. The samples turned transparent to deep brown color and then analyzed under UV–visible spectroscopy at the range of 250 to 700 nm wavelengths. Based on the maximum peak, 4 mM of AgNO3 was selected for the synthesis of nanoparticles on a large scale. 1 M of AgNO3 was mixed with 1 L of supernatant in 4 different beakers at the final concentration of 4 mM and kept in sunlight for 2 h and then centrifuged at 10,000g for 30 min. The pellet was washed three times with deionized water and measured the concentration of the synthesized nanoparticles after lyophilizing part of the colloidal sample.

2.4

2.4 Characterization of A. racemosus-AgCl-NPs

The size and shape were measured by Transmitted Electron Microscope (JEOL, Japan), the presence of elements were analyzed by the energy dispersive spectroscopy (EDX), crystal formation was detected by X-ray powder diffraction (XRD) and the functional groups were determined by Fourier transform infrared spectroscopy (FTIR, Perkin Elmer, Spectrum 100, USA) according to Kabir et al. (Kabir et al., 2020a, 2020b).

2.5

2.5 Glioblastoma stem cells (GSCs) and EAC cells culture

The human glioma stem cells-3 (GSCs) that was used in this experiment were isolated by the Kunming Institute of Zoology (Dai et al., 2017; Peng et al., 2020). The cells were culture according to Wan Peng et al. (Peng et al., 2020). For the treatment of GSCs with the synthesized A. racemosus-AgCl-NPs, at first 6 or 96 well flats bottom cell culture plates were coated with Laminin solution and phosphate buffer saline (1:100) and incubated at 37 °C for 2.0 h. Then PBS and the unbound Laminin were removed from the cell culture petri-dish or culture plates and GSCs in DMEM/F12 medium (Gibco) were seeded and cells were cultured in a 5% CO2 incubator at 37 °C until cells reached 80–90% confluence. EAC cells were propagated intraperitoneally in our Departmental Research Laboratory biweekly and the cells were collected from a donor Swiss albino mouse bearing 6–7-day-old ascites tumor.

2.6

2.6 MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)–2H-tetrazolium) assay

Cytotoxicity was checked by seeding 2 × 104 GSCs in each well of a 96 wells cell culture plate as described by Kabir et al. (Kabir et al., 2020b). Cells in DMEM/F12 medium were treated with 2.0 to 8.0 µg/ml concentration of A. racemosus-AgCl-NPs for 48 h. 8 × 104 EAC cells were added to the serially diluted nanoparticles with DMEM medium of each well of a 96 wells cell culture plate and incubated for 24 h. Finally, aliquot was removed from each well and the cells were incubated with the MTS for 2 to 4 h and the cell proliferation inhibition was calculated as described by Kabir et al. (Kabir et al., 2016). IC50 values were calculated using the Excel software.

2.7

2.7 Detection of apoptosis by annexin V/PI assay kit

GSCs (2×104/well) were seeded in a 96 wells plate and 24 h later, cells were treated with 8 μg/ml of A. racemosus-AgCl-NPs for 48 h. Then the cells were washed and stained with annexin V and PI (ebioscience, USA) according to the manufacturer's directions. Finally, a fluorescence microscope (Olympus IX71) was utilized for the detection of apoptosis.

2.8

2.8 Caspase immunofluorescence assay

For immune fluorescence assay, a 96 well cell culture plate was used for seeding GSCs (2 × 104 cells/well). Then the cells were treated with 8 μg/ml of AgCl-NPs for 48 h and then incubated for 1 h with 4% paraformaldehyde for cell fixation. After that 0.1% triton X-100 in PBS was added to the cell for 5 min and washed three times with PBS and 200 µl of 10% goat serum in PBS was added to each well and incubated for 1 h at room temperature. Subsequently, cells were washed with PBS for the removal of serum and 100 µl of the 400 times diluted (by 0.5% tween-20 and 1% BSA in PBS) caspase-3 primary antibody was added and incubated at room temperature for 1 h. Afterward, 0.1% tween-20 in PBS was used to wash the cells for 10 min and 100 µl of Cy3 goat-anti Rabbit IgG antibody (500 times diluted in PBS) was added to each well after removal of the tween-20 and incubated in dark for 2 h at room temperature. Finally, cells were observed in a fluorescence microscope.

2.9

2.9 Apoptosis related genes expression by real-time PCR

Around 32×104 GSCs were seeded in each well of the 6-wells plate and treated with A. racemosus-AgCl-NPs (8.0 μg/ml) for 24 h. Then RNA was isolated and cDNA was synthesized according to Kabir et al. (Kabir et al., 2020b). PCR sample was prepared using 2 × SYBR green master mix as described by the manufacturer (Applied Biosystems). Forward and reverse primers list was given in Table 1. 18s was used as a housekeeping gene. The condition was set up as 50 °C (2 min) and 95 °C (2 min) for 40 cycles 95 °C for 15 sec and 60 °C for 1 min. A Bio-rad thermal cycler (Bio-rad CFX96) was used. Finally, data were analyzed by Double Delta CT methods using MS Excel software.

Table 1 List of primers.
NFkB F CCAGTATCCCGGTCCAGCTAT
R CACGTCCAACTCACTCCAAGG
TNFα F ATTGCCGCAGAAAGTTCTACG
R GTCCAGTTTCGTCTTCAGCTC
18 s F GTAACCCGTTGAACCCCATT
R CCATCCAATCGGTAGTAGCG
TLR9 F CTGCCTTCCTACCCTGTGAG
R GGATGCGGTTGGAGGACAA
PARP F GGCCTCGGTGGATGGAATG
R GCAAACTAACCCGGATAGTCTCT
STAT3 F CAGCAGCTTGACACACGGTA
R AAACACCAAAGTGGCATGTGA
NOTCH2 F CAACCGCAATGGAGGCTATG
R GCGAAGGCACAATCATCAATGTT
EGFR F AGGCACGAGTAACAAGCTCAC
R ATGAGGACATAACCAGCCACC
P21 F TGCAACTACTACAGAAACTGCTG
R CAAAGTGGTCGGTAGCCACA
IKK F CCCAACGTATGTGGGACCAAG
R CACAGCGGTCTTTGCACTTAC
mTOR F GCTAGGTGCATTGACATACAACA
R AGTGCTAGTTCACAGATAATGGC

2.10

2.10 Cell cycle analysis

Different phases of the cell cycle were analyzed according to Islam et al. (Islam et al., 2018). In short, GSCs were treated with A. racemosus-AgCl-NPs (8.0 μg/ml) for 48 h. Then treated and untreated GSCs were detached and fixed with cold 70% ethanol. About 24 h later, ethanol was removed and cells were washed three times with PBS. The cells were treated with RNase A for 30 min at 37 °C. After that, the cells were treated with propidium iodide solution and the cell cycle was analyzed by flow cytometry (BD FACSCalibur, BD Biosciences).

2.11

2.11 In vivo anticancer activity

The in vivo anticancer activity of A. racemosus-AgCl-NPs was investigated against EAC cells by examining cell growth inhibition, tumor weight measurement, survival and hematological parameter analysis. For cell growth inhibition, EAC cells were collected from EAC-bearing mice in normal saline and 1 × 106 cells were injected intraperitoneally in 18 male adult Swiss albino mice (25.0 ± 2.0gm). After 24 h of EAC cells inoculation, the mice were randomly distributed into three (n = 6) groups and A. racemosus-AgCl-NPs injected in the mice of groups I and II at the doses of 2.0 and 4.0 mg/kg/day, respectively, for five consecutive days. Whereas group III serves as non-treated EAC-bearing control. On day seven, EAC cells from all animals were collected in normal saline and viable cells were counted under a light microscope using Trypan blue staining. Finally, the percentages of cell growths were calculated as previously described (Kabir et al., 2012). For tumor-burden, survival time and hematological analysis, male adult mice (n = 12) were inoculated with EAC cells (1 × 106). After 24 h, they were distributed into two groups (group I and group II). Group I received A. racemosus-AgCl-NPs (4.0 mg/kg/day) treatment for 10 consecutive days, whereas group II remained as non-treated control. Tumor weights were recorded every second day and the death of each animal was recorded for determining the survival rates of treated and non-treated animals (Kabir et al., 2012). Blood was collected from each animal by the tail puncture on day 10 for hematological parameters analysis.

3

3 Results

3.1

3.1 Synthesis of A. racemosus mediated of AgCl-NPs and characterization

Development of brown color appeared after the addition of AgNO3 solution in A. racemosus roots extract. The deepness of brown color was raised with the increase of the concentration of AgNO3 that indicates the formation of A. racemosus root extract-mediated AgCl-NPs. The maximum absorbance peak was estimated at 440 nm as shown in Fig. 1A. From 4 L of supernatant, 32 ml of silver chloride nanoparticles was obtained and 1 g of crystalline powder was obtained from 30 ml of the solution. The concentration of the remaining 2 ml solution was 33 mg/ml.

Synthesis and characterization of A. racemosus-AgCl-NPs. (A) Different spectra indicate the formation of nanoparticles at different concentrations of AgNO3. (B) TEM micrograph of the synthesized A. racemosus-AgCl-NPs. Morphology showing the A. racemosus-AgCl-NPs with different sizes. (C) Detection of the elements in A. racemosus-AgCl-NPs by EDX, (D) X-Ray Diffraction pattern (E) FTIR spectrum.
Fig. 1 Synthesis and characterization of A. racemosus-AgCl-NPs. (A) Different spectra indicate the formation of nanoparticles at different concentrations of AgNO3. (B) TEM micrograph of the synthesized A. racemosus-AgCl-NPs. Morphology showing the A. racemosus-AgCl-NPs with different sizes. (C) Detection of the elements in A. racemosus-AgCl-NPs by EDX, (D) X-Ray Diffraction pattern (E) FTIR spectrum.

The morphological characterization (such as size and shape) of the A. racemosus-AgCl-NPs were determined by TEM. Highly monodispersed spherical particles appeared with an average diameter of approximately 17.0 nm as evaluated by ‘ImageJ’ software (Fig. 1B). The main elements of the A. racemosus-AgCl-NPs were silver and chlorine as observed by EDX (Fig. 1C). The structural characterization showed that the nanoparticles were cubic. The observed reflection peaks and the corresponding crystallographic planes as shown in Fig. 1D recognized for the formation of A. racemosus-AgCl-NPs (Card no. 00–901-1666). The FTIR spectra for the functional characterization of the A. racemosus root extract and A. racemosus-AgCl-NPs were presented in Fig. 1E.

3.2

3.2 Cytotoxic test of A. racemosus-AgCl-NPs by MTS assay

GSCs and EAC cells were treated with the A. racemosus-AgCl-NPs at the concentration of 2.0 to 8.0 µg/ml. The nanoparticles suppressed the growth of GSCs in a dose-dependent manner. The GSCs growth inhibition was 35%, 50% and 63%, on the other hand, EAC cells growth inhibition was 85%, 55.6% and 8% at concentrations of 2.0, 4.0 and 8.0 µg/ml, respectively (Fig. 2A&B). IC50 was 4.8 µg/ml for GSCs and 4.69 µg/ml for EAC cells.

Antiproliferative activities of A. racemosus-AgCl-NPs against GSCs cells (A) and EAC cells (B) in vitro.
Fig. 2 Antiproliferative activities of A. racemosus-AgCl-NPs against GSCs cells (A) and EAC cells (B) in vitro.

3.3

3.3 Effect of A. racemosus-AgCl-NPs on GSCs morphological alteration

After treatment of GSCs with the A. racemosus-AgCl-NPs, both early and late apoptotic cells were observed in microscopic images, as shown in Fig. 3. The expression level of active caspase-3 protein was also significantly increased after treatment with A. racemosus-AgCl-NPs (Fig. 4).

Induction of apoptosis in GSCs. (A1) and (B1) control and treat GSCs cells, respectively (bright field microscopic view). (A2) and (B2) fluorometric view of control and treated GSCs after staining with annexin V. (A3) and (B3) fluorometric view of control and treated GSCs after staining with PI; (A4) representing merged of (A2) and (A3) and (B4) representing merged of (B2) and (B3) respectively. The green color indicates the early and red indicates the late apoptotic cells. The image was captured at 40x magnification and the solid bar indicated 20 µm.
Fig. 3 Induction of apoptosis in GSCs. (A1) and (B1) control and treat GSCs cells, respectively (bright field microscopic view). (A2) and (B2) fluorometric view of control and treated GSCs after staining with annexin V. (A3) and (B3) fluorometric view of control and treated GSCs after staining with PI; (A4) representing merged of (A2) and (A3) and (B4) representing merged of (B2) and (B3) respectively. The green color indicates the early and red indicates the late apoptotic cells. The image was captured at 40x magnification and the solid bar indicated 20 µm.
Immunofluorometric assay of the A. racemosus-AgCl-NPs against GSCs. (A) control GSCs and (B) treated GSCs. The image was captured at 40x magnification and the solid bar indicated 20 µm.
Fig. 4 Immunofluorometric assay of the A. racemosus-AgCl-NPs against GSCs. (A) control GSCs and (B) treated GSCs. The image was captured at 40x magnification and the solid bar indicated 20 µm.

3.4

3.4 Effect of A. racemosus-AgCl-NPs on the gene expressions of GSCs

After treatment of GSCs with A. racemosus-AgCl-NPs for 24 h, the expression level of the TLR9, NFκB, TNFα, p21 and IKK genes were increased while PARP, EGFR, NOTCH2, mTOR and STAT3 genes were decreased as shown in (Fig. 5).

Assessment of gene expression levels. (A) expression of TLR9, NFκB, TNFα, p21, IKK, (B) expression of PARP, EGFR, NOTCH2, mTOR and STAT3 genes after treatment of GSCs with A. racemosus-AgCl-NPs. A dashed line (black) indicates 1.0 expression level.
Fig. 5 Assessment of gene expression levels. (A) expression of TLR9, NFκB, TNFα, p21, IKK, (B) expression of PARP, EGFR, NOTCH2, mTOR and STAT3 genes after treatment of GSCs with A. racemosus-AgCl-NPs. A dashed line (black) indicates 1.0 expression level.

3.5

3.5 Analysis of cell cycle

Flow cytometry was used to check the effect of A. racemosus-AgCl-NPs on the different phases of the cell cycle of GSCs. In the control GSCs, percentages of the G0/G1, S, and G2/M phases were 59.32, 16.51, and 24.17%, respectively. After treatment, the percent of G0/G1 phase increased to 62.77%, with the decrease of S and G2/M phases to 13.58% and 23.65%, respectively. The above results indicated that the G0/G1 phase cell cycle arrest in GSCs after treatment with AgCl-NPs as shown in Fig. 6.

Effects of the AgCl-NPs on the cell cycle phases of GSCs. (A) The percentages of each cell cycle were analyzed based on mean values obtained from three independent experiments. (B) is representing the histogram of control GSCs and (C) after treatment with A. racemosus-AgCl-NPs. (n = 3, mean ± SD). *p < 0.05.
Fig. 6 Effects of the AgCl-NPs on the cell cycle phases of GSCs. (A) The percentages of each cell cycle were analyzed based on mean values obtained from three independent experiments. (B) is representing the histogram of control GSCs and (C) after treatment with A. racemosus-AgCl-NPs. (n = 3, mean ± SD). *p < 0.05.

3.6

3.6 AgCl-NPs inhibit EAC cells growth in Swiss albino mice

A. racemosus-AgCl-NPs inhibited EAC cells growth significantly in mice. Around 56.7% and 85.75% EAC cells growth inhibition was observed at the doses of 2.0 and 4.0 mg/kg/day, respectively, when compared to that of non-treated control cells (Fig. 7A).

In vivo anticancer activity of A. racemosus-AgCl-NPs against EAC cells. A) Percentages of EAC cells growth inhibition at the doses of 2.0 and 4.0 mg/kg/day following 5 consecutive days of treatment. B) Tumour weight of EAC-bearing mice receiving A. racemosus-AgCl-NPs and control mice. C) A. racemosus-AgCl-NPs treated and untreated EAC bearing mice on the 22nd day of EAC inoculation. D) Percentage of the increased life span of EAC-bearing mice receiving treatment and non-treated animals.. (n = 6, mean ± SD). **p < 0.01, ****p < 0.0001.
Fig. 7 In vivo anticancer activity of A. racemosus-AgCl-NPs against EAC cells. A) Percentages of EAC cells growth inhibition at the doses of 2.0 and 4.0 mg/kg/day following 5 consecutive days of treatment. B) Tumour weight of EAC-bearing mice receiving A. racemosus-AgCl-NPs and control mice. C) A. racemosus-AgCl-NPs treated and untreated EAC bearing mice on the 22nd day of EAC inoculation. D) Percentage of the increased life span of EAC-bearing mice receiving treatment and non-treated animals.. (n = 6, mean ± SD). **p < 0.01, ****p < 0.0001.

Treatment of EAC-bearing mice with A. racemosus-AgCl-NPs for 10 consecutive days at the dose of 4.0 mg/kg/day caused a significant reduction of tumor burden in EAC-bearing mice (Fig. 7B&C). The treatment also increased 69.38% of the life span of the EAC-bearing mice that received A. racemosus-AgCl-NPs in the present study (Fig. 7D).

Additionally, EAC-bearing mice receiving A. racemosus-AgCl-NPs treatment restored the blood parameters such as hemoglobin (Fig. 8A), red blood cell and white blood cell (Fig. 8B) counts in comparison to that non-treated EAC-bearing mouse. In EAC-bearing control mice, the hematological parameters deteriorate with the burden of tumor in comparison to that of normal mice. We have noted that treatment of EAC-bearing mice with AgCl-NPs revere back the deteriorate parameters to the normal levels (Fig. 8A&B).

Protective effects of A. racemosus-AgCl-NPs in EAC-bearing mice. A) Restoration of hemoglobin levels in EAC-bearing mice treated with A. racemosus-AgCl-NPs. B) Effects of A. racemosus-AgCl-NPs in EAC-bearing mice on RBC and WBC counts. A. racemosus-AgCl-NPs treatment reverses the blood cell counts to normal levels.
Fig. 8 Protective effects of A. racemosus-AgCl-NPs in EAC-bearing mice. A) Restoration of hemoglobin levels in EAC-bearing mice treated with A. racemosus-AgCl-NPs. B) Effects of A. racemosus-AgCl-NPs in EAC-bearing mice on RBC and WBC counts. A. racemosus-AgCl-NPs treatment reverses the blood cell counts to normal levels.

4

4 Discussion

Various cancer therapeutic agents stimulate cell apoptosis as the most efficient method for the treatment of cancer (Yang et al., 2015). Recently, the apoptotic inducers derived from phytochemicals have attracted much attention to researchers due to the less toxic effects than those of radiation and chemically synthesized chemotherapeutic agents. For this purpose, we attempted to synthesize silver nanoparticles from Zizyphus mauritiana fruit extract, Kaempferia rotunda tuberous rhizome and Geodorum densiflorum rhizome extracts. At that time, we obtained a mixture of AgNPs and AgCl-NPs from the extracts (Kabir et al., 2020a, 2020b, 2022). This time only AgCl-NPs were synthesized from A. racemosus roots extract and the formation of the nanoparticles/complex was confirmed preliminary from the deep brown color and the absorbance peaks at 440 nm that occurred for the surface plasmon resonance (Padalia et al., 2015; Singh et al., 2014).

Like most plant-mediated AgNPs, (Ahmed et al., 2016) highly monodispersed spherical particles appeared with an average diameter of approximately 17.0 nm. The crystalline system of the A. racemosus-AgCl-NPs was cubic, as confirmed by XRD. AgCl-NPs can be formed in different manners. In the present study, the formation of the AgCl-NPs can be explained as two steps process (Kang et al., 2016). At first, AgCl is formed by reacting Ag ions and chloride ions of the Tris-HCl buffer. Then A. racemosus-AgCl-NPs are formed by stabilizing the AgCl with different bioactive compounds of the A. racemosus root extract. FTIR peaks indicated the possibility of the content of several functional groups e.g. alcohols, phenols, proteins, enzymes, alkenes, esters or polysaccharides in the A. racemosus-AgCl-NPs.

Glioblastoma multiforme is the primary malignant brain tumor in humans, with a high morbidity rate and under standard treatment, the average overall survival time is approximately 14.6 months and <10% of patients survive around 5 years (Roger Stupp et al., 2009). Recently, CSCs have been identified in these tumors and named glioma stem cells (GSCs) (Sattiraju A et al., 2017). Since GBM is a highly vascularized tumor, it was speculated that GSCs might depend on a similar niche as neural stem cells (Sattiraju A et al., 2017). Various mechanisms, including genetics, epigenetics, metabolism, cellular microenvironment, niche factors, and the host immune system all regulate GSCs (Lathia et al., 2015; Wang et al., 2018). The GSCs seem to have cell renewal properties, and autophagy resists chemotherapy and differentiates to additional glioma cells, suspecting them the main mediators for tumor regrowth after treatment (Jiapaer et al., 2018; Louis, 2006). Several molecular resistance mechanisms of GSCs to therapies are dependent on alterations of different gene expressions which in turn underlie GBM pathogenesis (Lathia et al., 2015). Thus, it suggests that several therapeutic combination approaches are being pursued against these GSCs resistant mechanisms.

To evaluate the anticancer properties of the A. racemosus-AgCl-NPs, cytotoxicity against GSCs, was checked by MTS assay (at the doses of 2, 4, 8, 16 and 32 µg/ml). However, results of the higher doses (16, and 32 µg/ml) were not shown in the present study as growth inhibition of GSCs was not significantly higher relative to the dose of 8 µg/ml. GSCs were sensitive toward- the synthesized nanoparticles and the proliferation was inhibited in a dose-dependent way. The cell proliferation inhibition was due to the induction of apoptosis confirmed by FITC-annexin V/PI staining and observed the remarkable increase of caspase-3 protein expression determined by immunofluorescence assay. Various genes are associated with this apoptotic cell death and any modulation of these genes by cell surface receptor inhibitors or kinase inhibitors may inhibit GSC growth and renewal (Cheng et al., 2015). For example, the classical type of GBM is particularly characterized by the amplification of epidermal growth factor receptor (EGFR), which seems to be exclusively a mutated form of TP53 (Eskilsson et al., 2018; Figueroa et al., 2017). NOTCH, a neural stem cell marker is also up-regulated in this classical subtype of GBM (Brennan et al., 2009). EGFR activation and NOTCH signaling enhance GSC proliferation as well as the development of tumorigenesis through the activation of β-catenin. Here, A. racemosus-AgCl-NPs down-regulated EGFR and NOTCH2 expression, whose consequence effects might be the induction of apoptosis in GSCs. Thus, targeting these signaling pathways in GSCs would be helpful for the treatment of glioblastoma. Several studies reported the correlation between the GSCs and STATs expression (Sherry et al., 2009). STAT3 plays an essential role in the survival, invasion, and promotion of tumor cell proliferation, angiogenesis and pre-metastatic niche formation (Cao et al., 2010; Wang et al., 2009). Recently, it was reported that a small molecule WP1193, induced apoptosis in glioblastoma stem-like cells by inhibiting JAK2/STAT3 pathway and promoting cell-cycle arrest (Sai et al., 2012). Another report stated that a PARP inhibitor ABT-888, with TMZ and radiation, increases apoptosis in GBM cells (Barazzuol et al., 2013). Here, the anti-apoptotic STAT3 and PARP genes' expression was also down-regulated after A. racemosus-AgCl-NPs treatment. Consequently, caspase-3 protein expression was increased and the DNA repair mechanism led by PARP was inhibited. Thus, this strategy that blocks EGFR, NOTCH2, STAT3 and PARP pathways may prove more efficacious for sustained cancer treatment. The expression level of mTOR was also decreased that also supporting the induction of apoptosis.

After treatment of GSCs with the A. racemosus-AgCl-NPs, the expression of the toll-like receptor gene TLR9, Nuclear Factor Kappa B Subunit-1 NF-κB, tumor necrosis factor-alpha TNFα, an inhibitor of nuclear factor kappa-B kinase subunit beta IKK and p21 genes were increased significantly. In GSCs, cell proliferation, invasion, cell cycle progression and apoptosis are regulated by the NF-κB family members (Kim et al., 2016; Li et al., 2015; Yang et al., 2017; Zanotto-Filho et al., 2017). IκBα is the light polypeptide inhibitory gene of the nuclear factor of kappa and the phosphorylation of the gene caused the typical activation of NF-κB(p65) pathway (Patial et al., 2010). IKKα/β phosphorylation degrades IκBα that leads to the release of p65 & p50 and evoking the gene transcription by trafficking into the nucleus (Häcker and Karin, n.d.; Patial et al., 2010). Phosphorylation of IKK increased by the TNFα that causing the decreased level of IκBα consequently increasing the level of nuclear p65 (Gupta et al., 2013). TLRs play a role in the transcription of the NF-κB gene and activate pro-inflammatory cytokines, such as IL6 and TNFα through the adaptor molecule MyD88 (Medzhitov, 2001; Pasare and Medzhitov, 2005). NF-κB plays an anti-apoptotic and pro-apoptotic regulatory factor that is depending on the apoptotic stimulus (Kaltschmidt et al., 2000; Lin et al., 1999). Induction of apoptosis with the several-fold increase of NF-κB may state the role of pro-apoptotic genes. In the present study, A. racemosus-AgCl-NPs may cause activation of TNFα directly and/or through TLR9 that activated NF-κB by activating IKK and finally, DNA breakdown occurred. The expression level of the DNA repair gene PARP decreases due to the over-expression of caspase-3 protein. After treatment of GSCs with the A. racemosus-AgCl-NPs, G0/G1 cell cycle was arrested, supported by the overexpression of p21 gene. The caspase-3 protein and all gene expression data were pictorially represented in Fig. 9.

The possible schematic representation of AgCl-NPs mediated apoptosis and growth inhibition of GSCs.
Fig. 9 The possible schematic representation of AgCl-NPs mediated apoptosis and growth inhibition of GSCs.

In addition, the A. racemosus-AgCl-NPs significantly inhibited EAC cells proliferation in vitro and also inhibited the EAC cell growth, reduced tumor growth rate and burden, increased the survival and life span of tumor-bearing animals and restored the perturbed hematological parameters when compared with the non-treated control animals. These are the hallmark properties of potential and effective chemotherapeutic agents (Islam et al., 2012; Islam et al., 2015). In our previous K. rotunda-mediated Ag/AgCl-NPs inhibited 32.3% and 55% of EAC cells growth in vivo in mice at 6 and 12 mg/kg/day doses, respectively, Z. mauritiana-mediated Ag/AgCl-NPs inhibited only 20% of EAC cells growth at 12 mg/kg/day dose (Kabir et al., 2020b) and Hypnea musciformis‐mediated Ag/AgCl‐NPs inhibited d 22.83% and 51% of the EAC cell growth in vivo in mice when administered 1.5 and 3.0 mg/kg/day (i.p.), respectively, for 5 consequent days (Ghose et al., 2022). While in the present investigation 85.75% EAC cells growth inhibition was observed only at 4 mg/Kg/day doses. That indicated the synthesized nanoparticles are more effective than previously reported nanoparticles and less effective than G. densiflorum-Ag/AgCl-NPs that inhibited 95% EAC cells growth at the dose of 4 mg/Kg/day (Kabir et al. 2022). In cancer patent, the hemoglobin and RBC decreased with the increase of WBC. In the present study for the first time, we are reporting the synthesized nanoparticles increased the hemoglobin level and RBC towards the normal consequently in the decrease of WBC. After treatment with A. racemosus-AgCl-NPs, the tumor volume remained near to the normal mice while the weight of the control EAC-bearing mice significantly increased with the survival time.

5

5 Conclusion

The synthesized A. racemosus-AgCl-NPs supplementation inhibited proliferation of GSC cell in vitro and EAC cells both in vitro and in vivo significantly. The nanoparticles induce apoptosis of GSC cells by arresting cells at G0/G1 phase of the cell cycle via modulating the expression of cellular growth, kinetics, proliferation, survival and death-related genes. Whereas, a significant reduction of tumor burden and increased life-span (i.e. survival) of tumor-bearing mice along with restoration of the hematological parameter followed by A. racemosus-AgCl-NPs treatment indicated strong anticancer activity of the nanoparticles. Therefore, results from this study implied that A. racemosus-AgCl-NPs have potential anticancer properties, which could provide a new resource to designate an effective chemotherapeutic agent.

Acknowledgment

GSCs related to all works were done by the first author at the Kunming Institute of Zoology, China as a Visiting Scientist under the CAS-PIFI fellowship (Award No. 2017 VBB0001) where Professor Zhao Xudong provided laboratory facilities as a former Faculty member and was not interested to be an author. The rest of the works were done under the financial support of the Ministry of Science and Technology (Grant no:39.009.002.01.00.057.2015-2016/922/Phys-362), Bangladesh.

Experimental animals and ethical clearance

A total of 36 Swiss albino mice (males, 8 weeks old, 22–25 g weight) were obtained from the animal house of the Pharmacy Department, Jahangirnagar University, Dhaka and were housed in cages (6 mice/cage) with free access to food and water. All animals were kept under a 12-h/12-h light/dark cycle (lights on at 6:00 a.m.). The animals were treated according to the ethical principles for animal experimentation according to protocols approved by the Institutional Animal, Medical Ethics, Bio-safety and Bio-security Committee (IAMEBBC) for Experimentations on Animals, Human, Microbes and Living Natural Sources Institute of Biological Sciences (IBSc), the University of Rajshahi, Bangladesh (approved certificate No. 293(13)320-IAMEBBC/IBSc).

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. , , , , . A review on plants extract mediated synthesis of silver nanoparticles for antimicrobial applications: a green expertise. J. Adv. Res.. 2016;7:17-28.
    [CrossRef] [Google Scholar]
  2. , , , , , , , , , . In vivo antitumor activity of biosynthesized silver nanoparticles using Ficus religiosa as a nanofactory in DAL induced mice model. Colloids Surf. B Biointerfaces. 2013;108:185-190.
    [CrossRef] [Google Scholar]
  3. , , , . Vitis vinifera Assisted Silver Nanoparticles with Antibacterial and Antiproliferative Activity against Ehrlich Ascites Carcinoma Cells. J. Nanoparticles. 2016;2016:1-9.
    [CrossRef] [Google Scholar]
  4. , , , , , . Synthesis and characterization of Reishi mushroom-mediated green synthesis of silver nanoparticles for the biochemical applications. J. Pharm. Biomed. Anal.. 2020;178
    [CrossRef] [Google Scholar]
  5. , , , , , . Photo-catalytic, anti-bacterial, and anti-cancer properties of phyto-mediated synthesis of silver nanoparticles from Artemisia tournefortiana Rchb extract. J. Photochem. Photobiol. B Biol.. 2017;173:640-649.
    [CrossRef] [Google Scholar]
  6. , , , , , , . Efficacy of green nanoparticles against cancerous and normal cell lines: A systematic review and meta-analysis. IET Nanobiotechnol.. 2018;12:377-391.
    [CrossRef] [Google Scholar]
  7. , , , , , , . Emerging Theranostic Biogenic Silver Nanomaterials for Breast Cancer: A Systematic Review. J. Clust. Sci.. 2019;30:259-279.
    [CrossRef] [Google Scholar]
  8. , , , , , , , , . A systematic review of the genotoxicity and antigenotoxicity of biologically synthesized metallic nanomaterials: Are green nanoparticles safe enough for clinical marketing? Medicina (Kaunas).. 2019;55:439.
    [CrossRef] [Google Scholar]
  9. , , , , , , , . Evaluation of poly (ADP-ribose) polymerase inhibitor ABT-888 combined with radiotherapy and temozolomide in glioblastoma. Radiat. Oncol.. 2013;8:1-11.
    [CrossRef] [Google Scholar]
  10. , , , , , , , , . Non-hazardous anticancerous and antibacterial colloidal “green” silver nanoparticles. Colloids Surf. B Biointerfaces. 2013;105:37-42.
    [CrossRef] [Google Scholar]
  11. , , , , , , . Apoptosis inducing activity of steroidal constituents from Solanum xanthocarpum and Asparagus racemosus. Phytomedicine. 2018;17:789-793.
    [CrossRef] [Google Scholar]
  12. , , , , , , , . Glioblastoma Subclasses Can Be Defined by Activity among Signal Transduction Pathways and Associated Genomic Alterations. PLoS ONE. 2009;4:e7752
    [CrossRef] [Google Scholar]
  13. , , , , , , , , , . Erythropoietin receptor signaling through STAT3 Is required for glioma stem cell maintenance. Genes Cancer. 2010;1:50-61.
    [CrossRef] [Google Scholar]
  14. , , , , , , , , , , . Kinome-wide shRNA screen identifies the receptor tyrosine kinase AXL as a key regulator for mesenchymal glioblastoma stem-like cells. Stem Cell Rep.. 2015;4:899-913.
    [CrossRef] [Google Scholar]
  15. , , , , , , , , . Isocostunolide inhibited glioma stem cell by suppression proliferation and inducing caspase dependent apoptosis. Bioorg. Med. Chem. Lett.. 2017;27:2863-2867.
    [CrossRef] [Google Scholar]
  16. , , , , , , , , , , . EGFR heterogeneity and implications for therapeutic intervention in glioblastoma. Neuro. Oncol.. 2018;20:743-752.
    [CrossRef] [Google Scholar]
  17. , , , , , . Bioassay of Eucalyptus extracts for anticancer activity against Ehrlich ascites carcinoma (eac) cells in Swiss albino mice. Asian Pac. J. Trop. Bio.. 2012;2:394-398.
    [CrossRef] [Google Scholar]
  18. , , , , , , , , , , , . A p-menth-1-ene-4,7-diol (EC-1) from Eucalyptus camaldulensis Dhnh. triggers apoptosis and cell cycle changes in Ehrlich ascites carcinoma cells. Phytother. Res.. 2015;29:573-581.
    [CrossRef] [Google Scholar]
  19. , , , , , , . Detection of wild-type EGFR amplification and EGFRvIII mutation in CSF-derived extracellular vesicles of glioblastoma patients. Neuro. Oncol.. 2017;19:1494-1502.
    [CrossRef] [Google Scholar]
  20. , , . Biosynthesis of silver nanoparticles using the extract of Alternanthera sessilis-antiproliferative effect against prostate cancer cells. Cancer Nanotechnol.. 2013;4:137-143.
    [CrossRef] [Google Scholar]
  21. , , , , . Hypnea musciformis-mediated Ag/AgCl-NPs inhibit pathogenic bacteria, HCT-116 and MCF-7 cells’ growth in vitro and Ehrlich ascites carcinoma cells in vivo in mice. IET Nanobiotechnol. 2022;16(2):49-60.
    [CrossRef] [Google Scholar]
  22. , , , . Oncrasin targets the JNK-NF-κb axis to sensitize glioma cells to TNFα-induced apoptosis. Carcinogenesis. 2013;34:388-396.
    [CrossRef] [Google Scholar]
  23. Häcker, H., Karin, M., n.d. Regulation and function of IKK and IKK-related kinases. Sci. STKE 2006, re13. https://doi.org/10.1126/stke.3572006re13.
  24. , , , , , , , . Advances in immunotherapy for glioblastoma multiforme. J. Immunol. Res.. 2017;2017:1-11.
    [CrossRef] [Google Scholar]
  25. , , , , . Pea lectin inhibits cell growth by inducing apoptosis in SW480 and SW48 cell lines. Int. J. Biol. Macromol.. 2018;117:1050-1057.
    [CrossRef] [Google Scholar]
  26. , , . Potential strategies overcoming the temozolomide resistance for glioblastoma. Neurol. Med. Chir.. 2018;58:405-421.
    [CrossRef] [Google Scholar]
  27. , , , , , , , , , , , , , , . Zizyphus mauritiana Fruit Extract-Mediated Synthesized Silver/Silver Chloride Nanoparticles Retain Antimicrobial Activity and Induce Apoptosis in MCF - 7 Cells through the Fas Pathway. ACS Omega. 2020;5:20599-20608.
    [CrossRef] [Google Scholar]
  28. , , , , , , , , , . Biogenic silver/silver chloride nanoparticles inhibit human glioblastoma stem cells growth in vitro and Ehrlich ascites carcinoma cell growth in vivo. J. Cell. Mol. Med.. 2020;24:13223-13234.
    [CrossRef] [Google Scholar]
  29. , , , , . Asparagus racemosus and Geodorum densiflorum lectins induce apoptosis in cancer cells by altering proteins and genes expression. Int. J. Biol. Macromol.. 2021;191:646-656.
    [CrossRef] [Google Scholar]
  30. , , , , , . Purification, Characterizations of a Snake Guard Seeds Lectin with Anti- tumor Activity Against Ehrlich Ascites Carcinoma Cells In Vivo in Mice. Protein Pept. Lett.. 2012;19:360-368.
    [CrossRef] [Google Scholar]
  31. , , , , , , . Solanum tuberosum lectin inhibits Ehrlich ascites carcinoma cells growth by inducing apoptosis and G2/M cell cycle arrest. Tumor Biol.. 2016;37:8437-8444.
    [CrossRef] [Google Scholar]
  32. , , , . Biogenic silver/silver chloride nanoparticles inhibit human cancer cells proliferation in vitro and Ehrlich ascites carcinoma cells growth in vivo. Sci. Rep.. 2022;12(1):8909.
    [CrossRef] [Google Scholar]
  33. , , , , , , . The pro- or anti-apoptotic function of NF-κB is determined by the nature of the apoptotic stimulus. Eur. J. Biochem.. 2000;267:3828-3835.
    [CrossRef] [Google Scholar]
  34. , , , , , , . Antimicrobial silver chloride nanoparticles stabilized with chitosan oligomer for the healing of burns. Materials (Basel).. 2016;9:1-10.
    [CrossRef] [Google Scholar]
  35. , , , , . Serine/threonine kinase MLK4 determines mesenchymal identity in glioma stem cells in an NF-κB-dependent manner. Cancer Cell. 2016;29:201-213.
    [CrossRef] [Google Scholar]
  36. , , , , , . Cancer stem cells in glioblastoma. Genes Dev.. 2015;29:1203-1217.
    [CrossRef] [Google Scholar]
  37. , , , , . Advances in epigenetic glioblastoma therapy. Oncotarget. 2017;8:18577-18589.
  38. , , , , , , , , , , , , , , , . Non-canonical NF-κB signalling and ETS1/2 cooperatively drive C250T mutant TERT promoter activation. Nat. Cell Biol.. 2015;17:1327-1338.
    [CrossRef] [Google Scholar]
  39. , , , , , , , . NF-κ-B functions as both a proapoptotic and antiapoptotic regulatory factor within a single cell type. Cell Death Differ.. 1999;6:570-582.
    [CrossRef] [Google Scholar]
  40. , . Molecular pathology of Malignant Gliomas. Annu. Rev. Pathol. Mech. Dis.. 2006;1:97-117.
    [CrossRef] [Google Scholar]
  41. , . Toll-like receptors and innate immunity. Nat. Rev. Immunol.. 2001;1:135-145.
    [CrossRef] [Google Scholar]
  42. , , , . Shatavarins (containing Shatavarin IV) with anticancer activity from the roots of Asparagus racemosus. Indian J. Pharmacol.. 2012;44:732-736.
    [CrossRef] [Google Scholar]
  43. Ostrom, Q., Gittleman, H., Fulop, J., … M.L.-N., 2015, undefined, n.d. CBTRUS statistical report: primary brain and central nervous system tumors diagnosed in the United States in 2008-2012. academic.oup.com.
  44. , , , . Advances in glioblastoma multiforme treatment: New models for nanoparticle therapy. Front. Physiol. 2018
    [CrossRef] [Google Scholar]
  45. , , , . Green synthesis of silver nanoparticles from marigold flower and its synergistic antimicrobial potential. Arab. J. Chem.. 2015;8:732-741.
    [CrossRef] [Google Scholar]
  46. , , . Toll-like receptors: Linking innate and adaptive immunity. Adv. Exp. Med. Biol. 2005:11-18.
    [CrossRef] [Google Scholar]
  47. , , , , , . G-protein-coupled-receptor kinases mediate TNFα-induced NF-κB signalling via direct interaction with and phosphorylation of IκBα. Biochem. J.. 2010;425:169-180.
    [CrossRef] [Google Scholar]
  48. , , , , , , , , , . Identification of two mitochondrial-targeting cyclometalated iridium(III) complexes as potent anti-glioma stem cells agents. J. Inorg. Biochem.. 2020;203:110909
    [CrossRef] [Google Scholar]
  49. , , , , , , , , , , , , , , , , , , , , , , , . Effects of Radiotherapy With Concomitant and Adjuvant Temozolomide Versus Radiotherapy Alone on Survival in Glioblastoma in a Randomised Phase III Study: 5-year Analysis of the EORTC-NCIC Trial. Lancet Oncol.. 2009;10:459-466.
    [CrossRef] [Google Scholar]
  50. , , , , , . Adjuvant intraarterial chemotherapy with nimustine in the management of world health organization grade IV gliomas of the brain. Cancer. 1989;64:1984-1994.
    [CrossRef] [Google Scholar]
  51. , , , , , , , , , , , , , , , . Induction of cell-cycle arrest and apoptosis in glioblastoma stem-like cells by WP1193, a novel small molecule inhibitor of the JAK2/STAT3 pathway. J. Neurooncol.. 2012;107:487-501.
    [CrossRef] [Google Scholar]
  52. , , , . Glioblastoma Stem Cells and Their Microenvironment. Adv. Exp. Med. Biol.. 2017;1041:119-140.
    [CrossRef] [Google Scholar]
  53. , , , , . STAT3 is required for proliferation and maintenance of multipotency in glioblastoma stem cells. Stem Cells. 2009;27:2383-2392.
    [CrossRef] [Google Scholar]
  54. , , , , , , . Green synthesis of silver nanoparticles using cell extracts of Anabaena doliolum and screening of its antibacterial and antitumor activity. J. Microbiol. Biotechnol.. 2014;24:1354-1367.
    [CrossRef] [Google Scholar]
  55. , , , , , , , , , , , , , , , , , . A Novel Literature-Based Approach to Identify Genetic and Molecular Predictors of Survival in Glioblastoma Multiforme: Analysis of 14,678 Patients Using Systematic Review and Meta-Analytical Tools. J. Clin. Neurosci.. 2015;22:785-799.
    [CrossRef] [Google Scholar]
  56. , , , , , , , , , , , , , , , , . Targeting interleukin 6 signaling suppresses glioma stem cell survival and tumor growth. Stem Cells. 2009;27:2393-2404.
    [CrossRef] [Google Scholar]
  57. , , , , , , , . Bioinformatic analysis of gene expression and methylation regulation in glioblastoma. J. Neurooncol.. 2018;136:495-503.
    [CrossRef] [Google Scholar]
  58. , , , , . Brain tumor-targeted drug delivery strategies. Acta Pharm. Sin. B. 2014;4:193-201.
    [CrossRef] [Google Scholar]
  59. , , , , , , , , , , , , , , , , , , . Nifuroxazide induces apoptosis and impairs pulmonary metastasis in breast cancer model. Cell Death Dis.. 2015;6:e1701
    [CrossRef] [Google Scholar]
  60. , , , , , , , , , . miR-181d/MALT1 regulatory axis attenuates mesenchymal phenotype through NF-kB pathways in glioblastoma. Cancer Lett.. 2017;396:1-9.
    [CrossRef] [Google Scholar]
  61. , , , , , , , , . Inflammatory landscape of human brain tumors reveals an NFκB dependent cytokine pathway associated with mesenchymal glioblastoma. Cancer Lett.. 2017;390:176-187.
    [CrossRef] [Google Scholar]
Show Sections