Translate this page into:
Chemical characterization, antioxidant, cytotoxicity, and anti-human breast cancer potentials of Allium ampeloprasum green-formulated silver nanoparticles by investigating the p53 and cell cycle G1, S, G2, and M phases
* Corresponding author: E-mail address: xmmayfy@163.com (M. Xiong)
-
Received: ,
Accepted: ,
Abstract
In this study, we used the leaves of Allium ampeloprasum to report on biogenic supported silver nanoparticles (AgNPs). The leaves of Allium ampeloprasum were utilized as a green reducing agent and a superior stabilizer for the AgNPs that were synthesized. The as-synthesized AgNPs were physicochemically characterized by Fourier-transform infrared (FT-IR), X-ray diffraction (XRD), field emission-scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), UV-Vis, and energy dispersive X-ray (EDX). The antioxidant activity of the AgNPs was assessed using the DPPH assay; they showed significant antioxidant activity, as per the IC50 value. Because of their antioxidant qualities, recent nanoparticles seem to have an anti-human breast carcinoma effect. AgNPs that were biologically produced were evaluated for their anti-breast cancer properties against breast cancer cell lines. According to the MTT assay results, AgNPs’ anti-breast cancer qualities could effectively eradicate the MCF10 cancer cells, depending on both concentration and time. AgNPs induce cell death, followed by downregulation of the anti-apoptotic marker BCL-2 and overexpression of the pro-apoptotic markers BAX and cleaved caspase-8. Furthermore, in contrast to their corresponding control, Ag NPs prevented colony formation. More significantly, the investigation of molecular pathways of cells treated with AgNPs showed that increasing p53 expression. This implies that the extract’s pharmacological effects on human breast cancer cells were mostly caused by p53.
Keywords
Allium ampeloprasum
Human breast carcinoma
p53
Silver

1. Introduction
The second most common cause of cancer-related death in females is breast cancer [1]. In 2020, breast cancer was declared to be the most common carcinoma among females. In particular, women in developing nations aged 15-49 had twice as many cases of breast disease as those in developed nations [2]. Geographic variation, socioeconomic position, lifestyle, racial/ethnic background, genetic differences, and proximity to established hazard factors were the causes for disparity in occurrence. Additionally, the illness stage at diagnosis, the use of mammography, and the availability of appropriate care are all contributing factors to the rising incidence of breast cancer in women [3]. It can be challenging to diagnose and treat breast cancer since different subtypes of the disease are caused by diverse gene changes that occur in a population of luminal or basal progenitor cells. The treatment strategy will be either systematic or local, involving chemotherapy, radiation therapy, surgery, and hormone and medication targeted therapy, depending on the occurrence, kinds, and stage. Sometimes, the activities of several medications can be combined to treat breast cancer. Nowadays, nanoparticles can be employed as a drug delivery system to deliver the medication to specific cancerous cells.
Manufacturing, depicting, manipulating, and applying structures by manipulating their sizes and shapes at the nanoscale level is known as nanotechnology. The most promising field for developing new biotechnology and biomedicine applications that are connected to nanomedicine is nanotechnology, both now and in the future [4]. New avenues in the pharmacological and therapeutic fields have been made possible by the convergence of nanotechnology and nanomedicine [4]. Particles with dimensions between 1 and 100 nm are referred to as nanoparticles. Considering their unique size range of 1 nm to 100 nm, shape, and structure, they exhibit complete novelty and improved properties [4]. With the potential to be used as remedial compounds, anti-microbial agents, transfection vectors, and fluorescent labels, these compounds are increasingly being used in consumer goods and medical applications [4]. In general, nanoparticles fall into two categories: organic and inorganic NPs. While organic NPs include carbon NPs like carbon nanotubes, fullerenes, and quantum dots, inorganic NPs include semiconductor NPs like ZnS, CdS, and ZnO, metallic NPs like Ag, Cu, Au, Al, Ni, Co, and Fe. Silver (Ag) has exceptional biological, physical, and chemical properties that set it apart from other nanoparticles [5]. Colloidal silver is used to make ointments, bandages, and wound dressings as well as to treat bacterial infections in exposed wounds [6]. Furthermore, nanosilver is well-known for its commercial uses, such as contraceptive tablets for women to avoid getting pregnant and as a water disinfectant in agriculture to prevent disease [7]. Antimicrobial, anti-inflammatory, antioxidant, and antifungal properties have all been applied to silver nanoparticles (AgNPs) [8]. It is possible to create the nanoparticles using biological, chemical, and physical means. Initially, a modest production is obtained through the employment of physical means [9]. The chemical method reduces metallic ions to nanoparticles by using various chemical agents. The use of toxic chemicals, resulting in dangerous byproducts, poses some obstacles [10]. To produce metal nanoparticles that are reliable and beneficial to the environment, the organic molecules must undergo controlled assembly [11]. This biological technique is simple, less toxic, less time-consuming, inexpensive, and gives a high yield. Its value is further enhanced by its biocompatibility [11]. For the green synthesis of NPs, a variety of natural resources have been employed, including bacteria, yeast, viruses, fungi, algae, plants, and plant products [11]. Given the large-scale production of nanoparticles of various sizes and shapes, plants seem to be the most suitable creatures for this process [11].
Before the advent of modern medicine, medicinal plants were used for a long time to preserve health and treat a wide range of illnesses [12]. Certain natural products have been used in cancer chemoprevention to reduce the harm caused by cancer and to repress or inhibit carcinogenesis. The genus Allium of the Amaryllidaceae family comprises a variety of species, including Allium ampeloprasum L., Allium sativum L., and Allium cepa L. [13]. The Amaryllidaceae family includes the traditional plant Allium Ampeloprasum L., which is frequently used as a vegetable in Iranian cuisine. Apart from the plant’s nutritional worth, traditional herbal medicine describes many of its therapeutic qualities, such as immune-stimulating, anti-inflammatory, and anticancer effects [12-14]. A. ampeloprasum L. is frequently used by patients because of its therapeutic qualities, owing to an abundance of sulfur compounds [14]. Allicin and ajoene are the two most significant and well-known bioactive sulfur compounds. Because of its anti-inflammatory, anti-thrombotic, antibacterial, anti-cancer, and anti-atherosclerotic properties, allicin is good for human health [14,15]. A. ampeloprasum L. has a wide range of bioactive substances that are important for human nutrition, including sulfur-free polyphenolic components such as saponins, carotenoids, phytosterols, phenolic acids, flavonoids, tannins, flavonols, and anthocyanins. Antioxidants called polyphenols are crucial in halting oxidative damage to biological components, potentially reducing the risk of chronic illnesses [12-15]. The previous studies have indicated the anticancer effects of A. ampeloprasum due to its phenolic acids, flavonoids, tannins, and flavonols [14,15].
By monitoring the p53 signaling pathways, the current work determined the potential of AgNPs produced by a green formulation based on A. ampeloprasum L. leaves in normal cells human umbilical vein endothelial cells (HUVECs) and breast cancer cells (MCF10). The pathway might play a role in the activation of apoptosis and suppression of the cell cycle by AgNPs.
2. Materials and Methods
2.1. Materials
All chemicals were bought from Sigma-Aldrich and Merck. All compounds were utilized without purification.
2.2. Preparation of extract
A. ampeloprasum leaves were bought from a local market and allowed dry for 10 days in the shade. The plant was separately collected from a local market and identified by the Botany Department, Shanghai Jiao Tong University School of Medicine, No. 600, Yishan Road, Xuhui District, Shanghai, 200233, China. After that, it was broken into tiny bits and sieved through a 60 mesh size to create a fine powder. Then, the aqueous leaf extract was made by shaking 5 g of powder in 100 mL of double-distilled water. After 30 min of heating at 60°C in a water bath, the extract was collected by filtering it using Whatman filter paper [16].
2.3. Green mediation of AgNPs
To biosynthesize AgNPs, a solution containing 10−3 M AgNO3 was mixed in a 1:1 ratio with the aqueous extract of A. ampeloprasum. The black color suggested the synthesis of AgNPs. The reduced solution was centrifuged for 10 min at 10,000 rpm. Once centrifugation was complete, the supernatant was removed and discarded. To eliminate any contaminants, the pellets were washed three times using deionized water [16,17].
2.4. Chemical characterization of AgNPs
A field emission-scanning electron microscope (FE-SEM), Apreo Lo Vac, FEI, USA, was used to assess the surface topography of the AgNPs.
The UV-Vis pattern of AgNPs was measured with a Biospec-1601 UV-vis spectrophotometer manufactured by Shimadzu Corporation in Kyoto, Japan. For this, about 2 mL of the sample was taken and put into Quartz cuvette with the proper labels so that the maximum absorption properties linked to the nanoparticle production could be examined using UV-Vis spectroscopy. At wavelengths between 200 and 650 nm, the AgNPs were scanned.
To ascertain the crystalline size of the biogenic AgNPs and validate their crystalline structure, an X-ray diffraction (XRD) test was conducted.
The InfraRed Bruker Tensor 37 Fourier-transform infrared (FT-IR) Instrument was used at 400-4000 cm-1 in this study.
2.5. Anticancer potentials of AgNPs
The MTT assay and cell culture were carried out based on a previously published technique, using RPMI-1640 for MCF10 cells [16]. The National Cell Bank of Iran (NCBI), located at the Pasteur Institute in Iran, provided both kinds of cells, which were kept in adherent culture. Both MCF10 and HUVEC cells separately were kept in Dulbecco’s modified Eagle’s medium (DMEM). They were then incubated at 37°C with 5% CO₂. The attachment cells were treated with AgNPs for a whole day at incremental doses ranging from 1 to 1000 µg/mL. To assess cytotoxicity, 100 µL of MTT solvent (0.5 mg/mL) was added to each well in place of the medium. Each microplate also contained six vehicle control wells that contained either 0.5% dimethyl sulfoxide (DMSO) or culture media alone. The medium was carefully removed after 4 h of dark incubation at 37°C, and 0.1 mL of DMSO was added to each well. The wells were then mixed for 10 min. The absorbance (570 nm) was measured using a microplate reader. The following formula was used to calculate the cell viability (Eq. 1) [16]:
To get the IC50 values, GraphPad Prism version 9 was utilized. Moreover, the cellular morphology of both treated and untreated cells was examined using a phase-contrast inverted microscope (Olympus, Japan) fitted with a digital camera.
2.6. Molecular study
The apoptosis study was carried out using the method previously described by Kwak et al. (2021). Overnight, the cells were seeded at 105 cells/well to trigger apoptosis. Using the IC50 value, they were subsequently incubated for 24 h in the presence of AgNPs. The apoptotic rate of cells was detected using the Annexin V-FITC Apoptosis Detection Kit. According to the manufacturer’s instructions, the Annexin V-FITC detection working solution was added, and the cells were incubated in the dark for 15 min. Fluorescence intensity was then measured by flow cytometry, and the apoptotic rate was analyzed using FlowJo software [16].
The cell cycle analysis was carried out according to the protocol that Kwak et al. (2021) previously described. In 25 cm2 cell culture flasks, cells were cultured for the entire night. After culture, cells were exposed to AgNPs IC50 for a full day. The cells were pelleted by centrifugation and fixed in 70% ethanol for 3 h at -20°C. After fixation, the cells were stained with propidium iodide (PI). Red fluorescence was detected by flow cytometry at an excitation wavelength of 488 nm to reflect the DNA content, and cell cycle analysis was performed based on the distribution of DNA content [16].
Total RNA was extracted using the ZR® RNA MiniPrep Kit, and the manufacturer’s instructions were followed. The Promega AMV II Reverse Transcription System was used to synthesize the complementary DNA (cDNA). Quantitative real-time PCR was performed in 20 μL volumes using 2×SYBR™ Select Master Mix with gene-specific primers (0.4 μL each, 10 μM) under standard cycling conditions (95°C/10 min initial denaturation, 40 cycles of 95°C/15 sec and 60°C/1 min). The reaction system was placed on a fluorescence quantitative PCR instrument, and all experiments were independently repeated 3 times. Relative mRNA expression levels were calculated using the 2(-ΔΔCt) method [16] (Table 1).
| Gene | Accession Number | Primer | Sequences (5′ →3′) |
|---|---|---|---|
| β-actin | NM_001101 | Forward | CACCCGCGAGTACAACCTTC |
| Reverse | CCCATACCCACCATCACACC | ||
| P53 | NC_000077.6 | Forward | CCCAAACTGCTAGCTCCCAT |
| Reverse | GGAGGATTGTGTCTCAGCCC | ||
| Bax | NC_000073.6 | Forward | GGTTTCATCCAGGATCGAGCA |
| Reverse | TCCTCTGCAGCTCCATATTGC | ||
| Bcl-2 | NC_000067.6 | Forward | TGGGATGCCTTTGTGGAACT |
| Reverse | GCAGGTTTGTCGACCTCACT |
2.7. Antioxidant effects of AgNPs
The antioxidant activity of the produced NPs was examined using the DPPH free radical test, which was based on the techniques employed by the previous study [17]. When a material with the ability to donate hydrogen atoms was added to the alcoholic DPPH solution, the DPPH was decreased and became pale yellow instead of purple. Therefore, 2 mL of a freshly made methanolic solution (0.1 mM) of DPPH was combined with 2 mL of an AgNPs solution (1-1000 µg/mL). After that, the test tubes were placed in the dark for 30 min. At 517 nm, the absorbance was determined following incubation. Butylated hydroxytoluene (BHT), ranging in concentration from 1-1000 µg/mL, was utilized as a reference or control. A lower absorbance value indicates a higher free radical scavenging activity of the reaction mixture. Using BHT as a reference, Eq. (2) was applied to calculate the samples’ antioxidant capabilities by calculating their DPPH radical scavenging capabilities.
Where SCV is the DPPH radical scavenging effect, and AS and AC are the absorbance of the sample and control, respectively.
2.8. Statistical analysis
For the biological tests, descriptive statistics such as means and standard deviations were computed. The General Linear Model (GLM) process in SPSS was used to assess treatment efficacy (2022). For the first phase, the main analyses were one-way ANOVA, and for the second phase, two-way ANOVA. The Fisher’s Least Significant Difference test was used to compare the biological test means. Mean differences were deemed significant when the p-value<0.05.
3. Results and Discussion
3.1 FT-IR analysis
Green production of nanoparticles may be qualitatively investigated using the FT-IR spectroscopy method. Metal-oxygen connections are linked to the vibration bands in the wavenumber range below 700 cm-1. The organic functional groups present in the plant extract that are attached to the metallic nanoparticles’ surface are represented by the additional peaks. The AgNPs FT-IR spectra have been revealed in Figure 1. The Ag-O bonds are attributed to the vibration bands at 464 and 524 cm-1, which are comparable to the ones that Yu et al. (2024) [17] discovered for AgNPs. Secondary metabolites of terpenoid, flavonoid, and phenolic compounds, which are major ingredients in A. ampeloprasum L., have bonds of C-O, C=C, C=O, C-H, and O-H, which may be represented by the vibration bands at the other regions, such as 1026, 1163 to 1621, 2918, and 3422 cm-1. The aforementioned connection is supported by the similarity between the plant and nanoparticle spectra.

- FT-IR pattern of nanoparticles in the wavenumber of 400-4000 cm-1.
3.2. UV-Vis analysis
The production of the AgNPs was established using a UV-Vis spectroscopic technique, which has a wavelength range of 150-650 nm. The UV-Vis absorption spectra of Allium ampeloprasum-derived AgNPs showed an absorbance peak at 458 nm (Figure 2). A blue shift is observed as particle size decreases, causing the peak to move to a lower wavelength [18]. The ensuing absorption peaks show how AgNPs are produced using the green synthesis process and how light waves and the electrons in the nanoparticles vibrate together. The reported peak values fall inside the typical line of the light absorption region of AgNPs, which is 400-450 nm.

- UV-Vis pattern of nanoparticles in the wavelength range of 150-650 nm.
3.3. EDX analysis
Figure 3 shows that the presence of metallic silver ions was confirmed by the energy dispersive X-ray (EDX). According to the EDX spectrum, metallic silver ions showed a large absorption peak in the 3–3.5 keV region, while silver nanocrystals showed absorption peaks in the 2.5–3.7 keV range. AgNP peaks at 3.1 and 3.2 keV indicated that Ag NPs were present in the solution. Our results were in agreement with those of a few other researchers that reported the absorption peaks of silver ions using an EDX detector [16-18].

- EDX pattern of nanoparticles in the energy of 0-10 KeV.
3.4. XRD analysis
XRD assay was followed to determine the purity, phase composition, and crystallinity of the AgNPs (Figure 4). Distinct diffraction peaks at 2θ = 64.4°, 44.3°, and 38.5° correspond to the (220), (200), and (111) planes of Ag, reporting that these peaks align closely with the AgNPs standard fcc pattern (JCPDS file no. 01-1174).

- XRD pattern of AgNPs in the 2θ of 30° -70°.
3.5. Morphology analysis
Analyses of transmission electron microscopy (TEM) and FE-SEM images are among the methods used to characterize NPs and are helpful in analyzing the morphology of the generated NPs. The spherical NPs production is shown by the TEM and FE-SEM pictures taken from Ag nanoparticles under the given ideal circumstances (Figure 5). The size range of the produced Fe NPs was usually 25-65 nm. The nanoparticles were homogeneous and had a crystalline form. The prolonged waiting period for the examination resulted in some agglomeration of the AgNPs. Our analysis is supported by the FE-SEM results of Bialy et al. (2017), which demonstrate that a significant majority of AgNPs had spherical shapes (<100 nm in size) [18]. Previous studies that used FE-SEM to analyze the AgNPs morphology revealed that the produced nanoparticles were spherical and ranged in size from less than 100 nm [18].

- (a) FE-SEM and (b) TEM images of AgNPs.
3.6. Anticancer data analysis
One such effort is an investigation into the cytotoxic properties of nanoparticles in laboratory settings using the MTT test. The AgNPs IC50 value was 40 µg/mL when evaluated on MCF10 cells, which were used in this study along with HUVEC cells (Figure 6). Interestingly, the highest anticancer effects were observed at 125, 250, 500, and 1000 µg/mL. With an emphasis on finding different treatment approaches as a key goal of medical research, efforts are currently being made to identify effective and appropriate treatment methods. Furthermore, as illustrated in Figure 5, the AgNPs exhibited potent anticancer activity against these tumor cells and minimal toxicity action against HUVEC.

- The activities of Ag NPs@Allium ampeloprasum on (a) the normal and (b) breast cancer MCF10 cell viability.
The Ag NPs@Allium ampeloprasum significantly reduced (P≤0.01) colony formation and raised (P≤0.01) the release of reactive oxygen species (ROS), apoptosis, and LDH levels, while also dramatically regulating (P≤0.01) the p53 signaling pathway in the MCF-10 cells (Figures 7-9). The Ag NPs@Allium ampeloprasum significantly reduced (P≤0.01) the percentages of the S and G2 phases of cell cycle flow cytometry and increased (P≤0.01) the percentage of the G1 phase (Figure 8). The findings shown in Figures 6-9 demonstrate the protective effect of the Ag NPs@Allium ampeloprasum against endometrial cancer. The Ag NPs@Allium ampeloprasum considerably decreased (P≤0.01) the Bcl2 mRNA expression level while concurrently boosting (P≤0.01) the bax mRNA expression levels, according to further molecular data from the current investigation (Figure 9).

- The properties of Ag NPs@Allium ampeloprasum on (a) ROS, (b) apoptosis, (c) colony formation and (d) LDH release of MCF10. *indicate the significant difference (p < 0.05) between the Ag NPs@Allium ampeloprasum group and control group.

- The analysis of the (a) G0/G1, (b) S, and (c) G2/M phases of the breast cancer cells. *indicate the significant difference (p < 0.05) between the Ag NPs@Allium ampeloprasum group and control group.

- The properties of Ag NPs@Allium ampeloprasum on the mRNA expression level of (a) Bax, (b) Bcl2, (c) P53 of MCF10. *indicate the significant difference (p < 0.05) between the Ag NPs@Allium ampeloprasum group and control group.
3.7. Antioxidant data analysis
Figure 10 illustrates the antioxidant activity of AgNPs formulated by Allium ampeloprasum and BHT. The findings indicate that nanoparticles have a notable antioxidant capability in the antioxidant experiment. The DPPH activity of Ag NPs rose in a dose-dependent fashion.

- The antioxidant potentials of (a) BHT and (b) Ag NPs@Allium ampeloprasum against free radicals (%).
One of the many different ways that AgNPs work is by activating a variety of apoptotic pathways. Studies have shown that AgNPs can initiate the extrinsic route of apoptosis, which entails the interaction of matching ligands (TNF, TRAIL, or FAS) with death receptors (TNFR2, TNFR1, Fas, and the TRAIL receptors DR5 and DR4). Initiator caspases -10 and -8 are then activated, which spreads the proapoptotic stimulation [19]. Zizyphus mauritiana fruit extract was used to create AgNPs, which demonstrated exceptional antibacterial, antiproliferative, and antifungal properties. The IC50 was 28 μg/mL when MCF-7 cells were exposed to nanoparticles (16 nm). The engagement of one of the apoptotic pathways was shown by microscopic changes, higher ROS levels, and colony formation inhibition. Data showed that cells treated with nanoparticles had significantly higher levels of FADD and FAS, which are believed to be crucial for triggering the extrinsic apoptotic pathway. The membrane protein family member FAS and FADD are necessary proteins that ensure the initiator caspases -8 and -10 recruitment, which are used by NK cells and T lymphocytes to destroy target cancer cells [20,21]. The increase in caspase-8 expression induced two key elements of apoptosis: the decrease in uncleaved PARP and the executioner caspase-3 activation [22]. AgNPs derived from the aqueous extract of Balanites aegyptiaca increased the proapoptotic protein BIM, which belongs to the Bcl-2 protein family. In Caco-2 colorectal carcinoma cells, these AgNPs might interact with the anti-inflammatory IκBα and antiapoptotic BCL-2 proteins [23]. AgNPs can also be used as particles to induce the apoptosis extrinsic route by amplifying the effects of other chemicals. For example, AgNP-TRAIL conjugates, which belong to the TNF family, sensitized TRAIL-resistant glioblastoma cells and significantly increased caspase-9, -8, and -3/-7 activity [24].
One mechanism that has been extensively researched in relation to AgNPs is the mitochondrial apoptotic pathway activation [25]. The previous research has reported that AgNPs have a major efficacy on changes in Bcl-2 family protein levels, mitochondrial activity, and caspase activation. The primary cause is DNA damage, and its chromatin condensation and fragmentation are probably related to the production of ROS. Examples of this effect included the conjugation of AgNPs on MCF-7 cells by Rubus fairholmianus extract, the study of Calotropis gigantea ethanolic extract on Ehrlich-Lettre ascites carcinoma cells (EAC) [26], the effect of Beta vulgaris L. root extracts on HuH-7 cells [25], and the formulation of Catharanthus roseus that was effective on HepG2 cells [25]. In the event that DNA damage is not repaired and the cell cycle is not repeated, the p53 protein initiates the synthesis of proapoptotic proteins. These comprise members of the Bcl-2 family with a proapoptotic activity, such as BH3, and Bax-only proteins, such as Noxa, PUMA, Bid, Bim, and Bad [27]. AgNPs downregulated proteins of DNA repair and replication, such as helicase, PCNA, RFC-1, MRE11, Topo II α, NFKβ, DNA PKcs, Pol-ε, Pol-β, XRCC-1, Fen-1, and RPA [26]. This notable damage causes the upregulation of the DNA damage marker histone γ-H2AX, which activates p53 and facilitates the apoptotic process. The rise in Bax and associated protein expression following p53 activation is another significant stage. Bax may interact with the mitochondria’s outer membrane to form holes that harm the mitochondria irreversibly [28]. More proapoptotic proteins are released when the outer mitochondrial membrane depolarizes, which triggers the apoptosome [29]. The balance of these Bcl-2 protein family members was upset by decreased expression of antiapoptotic Bcl-xL and Bcl-2 [26,30-32] and increased expression of proapoptotic Bax and PUMA [32], which set off the mitochondria-mediated apoptosis pathway. The altered efficacy of these proteins causes mitochondrial malfunction, which hinders the production of ATP [33]. Some believe that AgNPs can interact directly with mitochondria and have particle-specific effects [34] or change enzymes that are necessary for the mitochondria’s proper function in addition to influencing Bcl-2 proteins by producing oxidative stress. Low concentrations of fructose-coated AgNPs inhibited PDK (pyruvate dehydrogenase kinase), which negatively regulates pyruvate dehydrogenase. In osteosarcoma cells, this led to increased glucose oxidation and decreased glycolysis. This explains the selective nature of these AgNPs, their preferential production of ROS, and their ability to induce apoptosis in cancer cells [35].
4. Conclusions
This study effectively employed a plant extract-based green formulation method for nanomaterials. The nanoparticles were characterized chemically by XRD, TEM, UV-Vis, EDX, FT-IR, and FE-SEM. The study results demonstrated the using Ag NPs in breast cancer treatment. It has been demonstrated that Ag NPs affect breast cancer cell viability. The findings indicate that the IC50 value, or NPs value, at which 50% of the MCF10 is affected is 40 µg/mL. It demonstrated exceptional effectiveness against tumor cells with the signaling pathway regulation without causing any substantial harm to HUVEC. The study’s findings imply that A. ampeloprasum L.-enabled AgNPs may one day find use in the medical industry.
CRediT authorship contribution statement
Lingli Lu, Junda Hu, and Maoming Xiong have a same role in conceptualization, investigation, acquisition, formal analysis, data curation, supervision, project administration, methodology, writing – original draft, and writing – review & editing.
Declaration of competing interest
There are no conflicts of interest.
Data availability
Data is available on request from the authors.
Declaration of generative AI and AI-assisted technologies in the writing process
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.
References
- Breast cancer pharmacogenetics: A systematic review. Pharmacogenomics. 2023;24:107-122. https://doi.org/10.2217/pgs-2022-0144
- [Google Scholar]
- Breast Cancer-Epidemiology, Risk Factors, Classification, Prognostic Markers, and Current Treatment Strategies-An Updated Review. Cancers. 2021;13:4287. https://doi.org/10.3390/cancers13174287
- [Google Scholar]
- Breast cancer: An up-to-date review and future perspectives. Cancer Commun (Lond). 2022;42:913-936. https://doi.org/10.1002/cac2.12358
- [Google Scholar]
- Advances in therapeutic applications of silver nanoparticles. Chemico-Biological Interactions. 2023;382:110590. https://doi.org/10.1016/j.cbi.2023.110590
- [Google Scholar]
- Silver chalcogenide nanoparticles: A review of their biomedical applications. Nanoscale. 2021;13:19306-19323. https://doi.org/10.1039/d0nr03872e
- [Google Scholar]
- Therapeutic advancements in nanomedicine: The multifaceted roles of silver nanoparticles. Biotechnology Notes. 2024;5:64-79. https://doi.org/10.1016/j.biotno.2024.05.002
- [Google Scholar]
- Therapeutic targeting potential of novel silver nanoparticles coated with anti-CD20 antibody against chronic lymphocytic leukemia. Cancers. 2023;15:3618. https://doi.org/10.3390/cancers15143618
- [Google Scholar]
- Green synthesis and characterisation of silver nanoparticles using cassia tora seed extract and investigation of antibacterial potential. Applied Biochemistry and Biotechnology. 2022;194:464-478. https://doi.org/10.1007/s12010-021-03651-4
- [Google Scholar]
- Synthesis and investigation on synergetic effect of activated carbon loaded silver nanoparticles with enhanced photocatalytic and antibacterial activities. Environmental Research. 2023;233:116431. https://doi.org/10.1016/j.envres.2023.116431
- [Google Scholar]
- Green synthesis of silver nanoparticles using latex of Jatropha curcas. Colloids and Surfaces A: Physicochemical and Engineering Aspects. 2009;339:134-139. https://doi.org/10.1016/j.colsurfa.2009.02.008
- [Google Scholar]
- “Green” nanotechnologies: Synthesis of metal nanoparticles using plants. Acta Naturae. 2014;6:35-44. https://doi.org/10.32607/20758251-2014-6-1-35-44
- [Google Scholar]
- In vitro evaluation of the neuroprotective potential of Olea dioica against Aβ peptide-induced toxicity in human neuroblastoma SH-SY5Y cells. Frontiers in Pharmacology. 2023;14:1139606. https://doi.org/10.3389/fphar.2023.1139606
- [Google Scholar]
- Comparative study of onion (Allium cepa) and Leek (Allium ampeloprasum): Identification of organosulphur compounds by UPLC-QTOF/MS and anticancer effect on MCF-7 Cells. Plant Foods for Human Nutrition (Dordrecht, Netherlands). 2019;74:525-530. https://doi.org/10.1007/s11130-019-00770-6
- [Google Scholar]
- Changes in phenolic compounds in garlic (Allium sativum L.) owing to the cultivar and location of growth. Plant Foods for Human Nutrition (Dordrecht, Netherlands). 2011;66:218-223. https://doi.org/10.1007/s11130-011-0236-2
- [Google Scholar]
- Comparative studies of nutritional and health-enhancing properties in the “garlic-like” plant Allium ampeloprasum var. ampeloprasum (GHG-L) and A. sativum. Scientia Horticulturae. 2016;201:247-255. https://doi.org/10.1016/j.scienta.2016.01.044
- [Google Scholar]
- The 3-deoxysappanchalcone induces ROS-mediated apoptosis and cell cycle arrest via JNK/p38 MAPKs signaling pathway in human esophageal cancer cells. Phytomedicine. 2021;86:153564. https://doi.org/10.1016/j.phymed.2021.153564
- [Google Scholar]
- Characterization and cytotoxicity, antioxidant, and anti-lung carcinoma effects of Matricaria chamomilla extract green-synthesized Ag nanoparticles: Describing a modern chemotherapeutic supplement. Inorganic Chemistry Communications. 2024;168:112904. https://doi.org/10.1016/j.inoche.2024.112904
- [Google Scholar]
- Cytotoxic effect of biosynthesized silver nanoparticles on Ehrlich\nAscites tumor cells in mice. International Journal of Pharmacology. 2017;13:134-144. https://doi.org/10.3923/ijp.2017.134.144
- [Google Scholar]
- Targeting apoptosis in cancer therapy. Nature reviews. Clinical Oncology. 2020;17:395-417. https://doi.org/10.1038/s41571-020-0341-y
- [Google Scholar]
- Natural killer (NK) cell–mediated cytotoxicity: Differential use of TRAIL and Fas ligand by immature and mature primary human NK cells. J Exp Med. 1998;188:2375-2380. https://doi.org/10.1084/jem.188.12.2375
- [Google Scholar]
- FADD adaptor in cancer. Medical Immunology (London, England). 2005;4:1. https://doi.org/10.1186/1476-9433-4-1
- [Google Scholar]
- Zizyphus mauritiana fruit extract-mediated synthesized silver/silver chloride nanoparticles retain antimicrobial activity and induce apoptosis in MCF-7 cells through the Fas pathway. ACS Omega. 2020;5:20599-20608. https://doi.org/10.1021/acsomega.0c02878
- [Google Scholar]
- Induction of apoptosis in human cancer cells through extrinsic and intrinsic pathways by balanites aegyptiaca furostanol saponins and saponin-coated silvernanoparticles. Applied biochemistry and biotechnology. 2017;182:1675-1693. https://doi.org/10.1007/s12010-017-2426-3
- [Google Scholar]
- TRAIL-conjugated silver nanoparticles sensitize glioblastoma cells to TRAIL by regulating CHK1 in the DNA repair pathway. Neurological Research. 2020;42:1061-1069. https://doi.org/10.1080/01616412.2020.1796378
- [Google Scholar]
- Eco-Friendly preparation of silver nanoparticles and their antiproliferative and apoptosis-inducing ability against lung cancer. Life. 2022;12:2123. https://doi.org/10.3390/life12122123
- [Google Scholar]
- Synthesis and characterization of biogenic metal nanoparticles and its cytotoxicity and anti-neoplasticity through the induction of oxidative stress, mitochondrial dysfunction and apoptosis. Colloids and Surfaces. B, Biointerfaces. 2018;161:111-120. https://doi.org/10.1016/j.colsurfb.2017.10.040
- [Google Scholar]
- Apoptosis: A comprehensive overview of signaling pathways, morphological changes, and physiological significance and therapeutic implications. Cells. 2024;13:1838. https://doi.org/10.3390/cells13221838
- [Google Scholar]
- Bax, Bak and beyond — mitochondrial performance in apoptosis. The FEBS Journal. 2018;285:416-431. https://doi.org/10.1111/febs.14186
- [Google Scholar]
- Molecular determinants of the caspase-promoting activity of Smac/DIABLO and its role in the death receptor pathway. The Journal of Biological Chemistry. 2000;275:36152-36157. https://doi.org/10.1074/jbc.C000533200
- [Google Scholar]
- Biosynthesis, characterization, and anticancer effect of plant-mediated silver nanoparticles using Coptis chinensis. International Journal of Nanomedicine. 2019;14:1969-1978. https://doi.org/10.2147/IJN.S188235
- [Google Scholar]
- Silver nanoparticles exert apoptotic activity in bladder cancer 5637 cells through alteration of Bax/Bcl-2 genes expression. Chonnam Medical Journal. 2022;58:102-109. https://doi.org/10.4068/cmj.2022.58.3.102
- [Google Scholar]
- Manilkara zapota (L.) P. Royen Leaf extract derived silver nanoparticles induce apoptosis in human colorectal carcinoma cells without affecting human lymphocytes or erythrocytes. Biological Trace Element Research. 2019;192:160-174. https://doi.org/10.1007/s12011-019-1653-6
- [Google Scholar]
- Cytotoxic potential and molecular pathway analysis of silver nanoparticles in human colon cancer cells HCT116. International Journal of Molecular Sciences. 2018;19:2269. https://doi.org/10.3390/ijms19082269
- [Google Scholar]
- Silver nanoparticles Induce Apoptosis in HepG2 Cells through particle-specific effects on mitochondria. Environmental Science & Technology. 2022;56:5706-5713. https://doi.org/10.1021/acs.est.1c08246
- [Google Scholar]
- Fructose-coated Angstrom silver inhibits osteosarcoma growth and metastasis via promoting ROS-dependent apoptosis through the alteration of glucose metabolism by inhibiting PDK. Theranostics. 2020;10:7710-7729. https://doi.org/10.7150/thno.45858
- [Google Scholar]
