5.2
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
5.3
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
View/Download PDF

Translate this page into:

Original Article
2025
:18;
692025
doi:
10.25259/AJC_69_2025

Design and synthesis of magnetic chitosan-supported gold nanoparticles for the treatment of heart failure following myocardial infarction

, , , , , , , ,
aDepartment of Cardiovascular Medicine, Shanxi Bethune Hospital, Shanxi Academy of Medical Sciences, Third Hospital of Shanxi Medical University, Tongji Shanxi Hospital, NO.99, Longcheng Dajie, Taiyuan, Shanxi, 030032, China
bDepartment of Biology, College of Science, King Khalid University, 61421 Abha, Saudi Arabia
cDepartment of Zoology, Faculty of Science, Damanhour University, Damanhour, Egypt
dDepartment of Biology, Nutrition and Food Science, College of Science, King Khalid University, P.O. Box 960, Abha,61421, Saudi Arabia
eDepartment of Biology, College of Science, University of Hafr Al Batin, Hafr Al Batin 39524, Saudi Arabia

* Corresponding author: Email address: xiaolong.M@outlook.com (X. Mi)

Received: , Accepted: ,
© 2025 Arabian Journal of Chemistry - Published by Scientific Scholar
Licence
This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-Share Alike 4.0 License, which allows others to remix, transform, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.

Abstract

The development and formulation of innovative therapeutic supplements and medications with high efficacy for treating severe cardiovascular diseases (CVDs) is a priority for both developing and developed nations. This study details the sustainable synthesis of magnetic chitosan decorated with gold nanoparticles (Au NPs), accompanied by an in-depth analysis of its properties in the treatment of heart failure following myocardial infarction for the first time. The magnetic chitosan biopolymers were engineered to function as an environmentally friendly capping agent, effectively binding to and stabilizing gold ions, which were reduced using green tea extract. To evaluate and characterize the physicochemical properties of the synthesized CS-Fe3O4/Au NPs, various analytical techniques, such as scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transform infrared (FT-IR) spectroscopy, energy dispersive X-ray (EDX), inductively coupled plasma (ICP), vibrating sample magnetometer (VSM), and X-ray diffraction (XRD), were employed. The nanoparticles (NPs) are uniformly sized and nearly spherical, with sizes ranging from 20 to 40 nm. Saturation magnetization (Ms) values of 60.2 and 24.9 emu/g were found in the VSM analysis of Fe3O4 and CS-Fe3O4/Au NPs nanocomposites, respectively. The cardiac function was determined by electrocardiogram (ECG) readings, along with histochemical and biochemical analyses after inducing myocardial infarction using isoproterenol in C57BL/6 mice. The CS-Fe3O4/Au NPs administration markedly reduced characteristic ST segment depression, enhanced the ventricular wall infarction condition, suppressed myocardial injury markers levels, reduced mortality rates, and diminished the inflammatory environment in the hearts, effectively inhibiting the proinflammatory cytokines enhancement as compared to that observed in mice with myocardial infarction. One possible explanation for the beneficial effects of CS-Fe3O4/Au NPs is the normalization of Pparγ gene expression and the phosphorylation pathways involving PPAR-Υ/NF-κB/ΙκB-α/ΙKΚα/β. CS-Fe3O4/Au NPs demonstrated cardioprotective properties against myocardial infarction. Our research collectively demonstrates a current remedial approach for the clinical management of myocardial infarction.

Keywords

Cardioprotective effects
Chitosan
Gold
Magnetic nanoparticles
Myocardial infarction

1. Introduction

The increase in the prevalence of ischemic heart disease represents a remarkable public health concern. The most detrimental form of this condition is acute myocardial infarction, which leads to tissue damage and reduced cardiac function, contributing to two out of five fatalities in China [1]. Timely revascularization following a myocardial infarction, which encompasses percutaneous coronary intervention, thrombolytic therapy, and bypass surgery, is essential for enhancing cardiac function and averting post-infarction pathophysiological remodeling [2-5]. The effectiveness of these invasive methods is constrained by their applicability to certain patients, as it is dependent on specific clinical characteristics [6-10]. Additionally, there is a risk of serious complications, including bleeding and reperfusion injury, which further limits their use [2,11-14]. Efforts to enhance prognosis and decrease infarct size by pharmacological interventions, such as antiplatelet agents, antiarrhythmic medications, and angiotensin-converting-enzyme inhibitors (ACE) inhibitors, in the absence of reperfusion, have generally been found to be ineffective [15-19]. This ineffectiveness is attributed to the non-specific distribution of the drugs, their associated side effects, and the short half-lives of certain medications [1,11,20, 21]. Several patients who undergo this approach continue to experience progression to cardiac hypertrophy and heart failure [1]. The development and disruption of atherosclerotic plaques are related to acute myocardial infarction [20]. These treatments can reduce the incidence of myocardial infarction in atherosclerotic people, but the effectiveness of these treatments differs among individuals and still results in considerable residual risks [22-25]. Chemotherapeutic agents appear to offer positive outcomes in atherosclerosis treatment. Nevertheless, the systemic use of these medications is constrained due to their associated side effects [23,24]. Consequently, there is a growing need for effective and safer therapeutic options and preventive measures for myocardial infarction [23-25]. Numerous optimized strategies have been investigated to date, one of which involves nanoparticles (NPs) [26,27]. These nanoscale particles have found extensive application in the treatment of cardiovascular diseases (CVDs) [25].

Metal NPs exhibit exceptional optical, electrical, material, and chemical properties, which are strongly influenced by their size and shape [28]. These distinctive characteristics make them highly valuable for a variety of applications, including chemical and biological sensing [29], efficient extraction [30], catalysis [31,32], therapy [33,34], bioimaging [35], drug-delivery [36], and more. Of particular interest is the remarkable catalytic efficiency, which is notably enhanced at the nanoscale compared to bulk materials, making them a key focus of research as advanced nanomaterials [37]. Unlike bulk substances, NPs have a higher proportion of atoms located at their edges and corners, where they are surrounded by fewer neighboring atoms. These exposed surface atoms exhibit significantly higher chemical reactivity than those in the bulk phase [38-41].

Gold nanoparticles (Au NPs) have demonstrated significant potential in tumor imaging and cardiovascular health. Gold is an inert noble metal, that is stable and biocompatible. The forms and sizes of gold particles range from 1 to 500 nm, and they can be crescents, stars, cages, spheres, rods, or prisms [39]. Gold particles are eliminated by the kidneys. By affixing chitosan or PEG chains to the surface of the nanoparticle, one may modify its hydrophilicity and circulation time, so altering the elimination rate by glomerular filtration [40]. Cardiovascular optical imaging can benefit from the use of Au NPs. Photoacoustic imaging relies on the detection of both optical and ultrasonic imaging, where light is employed as an excitation source and ultrasonography detects sound waves produced by the target to provide pictures of optical absorption [41]. In this study, we present a green approach for the synthesis of Au NPs supported on chitosan-modified magnetic NPs, using green tea extract as a reducing agent (CS-Fe3O4/Au NPs) (Scheme 1). The nanocomposite was synthesized by coating Fe3O4 NPs with chitosan, which facilitated the binding of gold ions through its polar network. Au NPs were then formed in situ with the assistance of green tea extract. The CS-Fe3O4/Au NPs nanocomposite was characterized using various advanced techniques, such as transmission electron microscopy (TEM), energy dispersive X-ray (EDX), Fourier transform infrared (FT-IR), field emission-scanning electron microscopy (FE-SEM), elemental mapping, X-ray diffraction (XRD), vibrating sample magnetometer (VSM), and inductively coupled plasma-optical emission spectroscopy (ICP-OES). This novel CS-Fe3O4/Au NPs nanocomposite was subsequently employed for the treatment of heart failure following myocardial infarction for the first time. Myocardial infarction was induced in C57BL/6 mice through the subcutaneous administration of isoproterenol. The cardiac function in the group treated by CS-Fe3O4/Au NPs nanocomposite was determined by electrocardiogram (ECG) readings, along with histochemical, immunological, cellular, molecular, and biochemical analyses.

A schematic fabrication process for CS-Fe3O4/Au NPs.
Scheme 1. A schematic fabrication process for CS-Fe3O4/Au NPs.

2. Materials and Methods

2.1. Preparation of green tea aqueous extract

We added 1.0 g of green tea powder to 20 mL of pure water and stirred the mixture at 80°C for 20 min. The pale green extract was then filtered through Whatman-1 filter paper and kept for the next step.

2.2. Production of the CS-Fe3O4/Au NPs nanocomposite

First, 0.2 g of chitosan was dissolved in 50 mL 1% aqueous acetic acid solution by stirring for 20 min. Then, 0.5 g of the as-prepared Fe3O4 NPs via sonication for 20 min was added to the above chitosan solution and stirred for 5 h. Next, an aqueous solution of HAuCl4 (30 mg in 10 mL) was added to the suspension and stirred for 5 min at 80°C. Next, 10 mL of green tea extract was then suspended in this solution at the same temperature and stirred for 60 min. The resulting nanocomposite (CS-Fe3O4/Au NPs) isolated magnetically. Finally, it was washed thoroughly with DI water and dried under a vacuum. The Au content was measured by ICP-OES, to be 0.068 mmol/g.

2.3. Animals

In this research, 80 male C57BL/6 mice (38-40 g) were maintained in a controlled environment with temperatures ranging from 20 to 25°C. All procedures performed during this research adhered strictly to ethical guidelines for the laboratory animal’s treatment.

2.4. Cardioprotective effects of CS-Fe3O4/Au NPs nanocomposite

  • a)

    Myocardial infarction + CS-Fe3O4/Au NPs nanocomposite (100 µg/kg).

  • b)

    Myocardial infarction + CS-Fe3O4/Au NPs nanocomposite (200 µg/kg).

  • c)

    Control group: Mice in the normal group received normal saline.

  • d)

    Myocardial infarction group: The untreated mice received normal saline.

The doses of CS-Fe3O4/Au NPs nanocomposite for the treatment of heart failure following myocardial infarction were selected according to the data of the previous pilot study [42].

Using the technique outlined in the previous study, myocardial infarction was caused by subcutaneously delivering isoproterenol (85 mg/kg) for 2 days in a row, separated by 24 h, after the animals had become acclimated to their environment. Four of the mice shed the day after the injection, so they had to be replaced right away. The infarction induction was conducted by established protocols. Following this, a group of animals was anesthetized, and left ventricle samples were examined utilizing hematoxylin & eosin (H&E) methods. The white region identification indicated the heart attack necrotic damage [42].

2.5. Determination of the biochemical and immunological parameters

After the last isoproterenol administration, the animals were placed under anesthesia. The ST-segment elevation occurrence or depression in the subjects was assessed. On the 5th day, the animals were euthanized to analyze the biochemical and immunological parameters. The cytokine expression levels in the homogenized left ventricular heart supernatant were evaluated using ELISA kits. The degree of cellular injury was assessed by analyzing the serum troponin concentrations through the ELISA assay [42].

2.6. Determination of the molecular parameters

The analyzed heart RNA extracted was obtained using the Qiasol kit (Qiagen) according to the supplied guidelines. A Nanodrop spectrophotometer was used to assess the concentration and purity of the isolated RNA. After evaluating the samples’ optical absorption at 275 nm, the concentration was computed using the dilution factor expressed in µL/ng. After that, a 1000 pg/µL RNA solution was used for the creation of cDNA. This was achieved by combining 104 nL of RNA with 104 nL of a cDNA synthesis kit. After that, the resultant solution was put into a thermocycler and incubated for 10 min at 25°C and then for another 50 min at 60°C. At -20°C, the finished cDNA was stored for quantitative PCR analysis. The rate of gene replication was measured using the polymerase chain reaction. The β-actin (Actb) gene was used as the reference gene in this investigation. There were many steps in the temperature protocol for the Ppar/Gapdh gene amplification, which included PPAR-γ, PPAR-γ/NF-κB/ΙκB-α/ΙKΚα/β, β-actin, NF-κB, and MAPK. After 4 min of primary denaturation at 94°C, a 1-min secondary denaturation phase was carried out at the same temperature. Primary synthesis was conducted for 1 min at 52°C after the binding temperature was set for 60 s at 55°C. This procedure was carried out for a total of 40 cycles, which included steps 2 through 4, and was finalized with the concluding synthesis. Following 18 min at 52°C, the collected graphs were analyzed, and changes in gene expression were assessed using ΔΔCT analysis, based on the CT differences between the various intervention groups. The β-actin gene expression was calculated using the following primer sequence: forward primer CCTGCACTGAATCAAGAGGTTGC and reverse primer CCATCAGAAGGACTTGCTGGCT [42].

2.7. Statistical analysis

In this research, the data normality was checked using Minitab-21. Following this assessment, any data that did not conform to a normal distribution was normalized. Excel software created the graphic representations, while SPSS-22 was used to assess the data’s variance (p<0.01).

3. Results and Discussion

A post-synthetic functionalization approach was used to create a novel CS-Fe3O4/Au NPs under mild conditions. The synthesized nanocomposite was first characterized using FT-IR spectroscopy, as depicted in Figure 1. The primary component, Fe3O4 NPs, was identified by absorption peaks at 574 and 620 cm-1, assigned to Fe–O stretching vibrations. Furthermore, the characteristic peaks of chitosan were observed at 1039, 1379, 1606, and 3434 cm-1, corresponding to C-N stretching, C-O stretching, N-H bending, C=O stretching, O-H stretching, and N-H stretching, respectively. The presence of palladium nanoparticles was further confirmed by TEM, EDX, and XRD analyses.

The shape and morphology of the CS-Fe3O4/Au NPs were studied using FE-SEM imaging, as shown in Figure 2. The NPs appeared nearly spherical and uniform, with sizes ranging from 20 to 40 nm. Figure 3 displays the EDX spectrum, confirming the presence of Fe, Au, C, N, and O as the constituent elements.

FT-IR spectrum of CS-Fe3O4/Au NPs.
Figure 1. FT-IR spectrum of CS-Fe3O4/Au NPs.
FE-SEM image of CS-Fe3O4/Au NPs.
Figure 2. FE-SEM image of CS-Fe3O4/Au NPs.
EDX spectrum of CS-Fe3O4/Au NPs.
Figure 3. EDX spectrum of CS-Fe3O4/Au NPs.

TEM analysis was performed to obtain precise information about the as-prepared CS-Fe3O4/Au NPs nanocomposite (Figure 4). The image reveals a cotton-like appearance, consisting of two distinct types of particles. The smaller, gray-colored particles embedded within are the Fe3O4 NPs, while the larger, darker particles at the periphery are the Au NPs. The Au NPs appear to have a size range of approximately 20-40 nm.

TEM images of CS-Fe3O4/Au NPs. (a) 250 nm (b) 60 nm.
Figure 4. TEM images of CS-Fe3O4/Au NPs. (a) 250 nm (b) 60 nm.

Further, purity and crystalline structure of Fe3O4 and CS-Fe3O4/Au NPs were investigated by XRD analysis (Figure 5). On these curves, the (220), (311), (400), (422), (511), and (440) crystal planes of the Fe3O4 NPs show the cubic patterns of Fe3O4 NPs (JCPDS No. 19-0629). Also, the other observed bands of the final composite at 38.9° (111), 44.5° (200), 64.5° (220), and 77.7° (311) exhibited the fcc Au crystals that immobilized over the magnetite composite.

XRD pattern of (a) Fe3O4 and (b) CS-Fe3O4/Au NPs.
Figure 5. XRD pattern of (a) Fe3O4 and (b) CS-Fe3O4/Au NPs.

The VSM study of Fe3O4 and CS-Fe3O4/Au NPs nanocomposites showed saturation magnetization (Ms) values of 60.2 and 24.9 emu/g, respectively (Figure 6). These values indicate that the samples are superparamagnetic composites.

VSM analysis of (a) Fe3O4 and (b) CS-Fe3O4/Au NPs.
Figure 6. VSM analysis of (a) Fe3O4 and (b) CS-Fe3O4/Au NPs.

Animals were given isoproterenol to cause myocardial infarction in a recent study. Elevated levels of isoproterenol quickly increase the burden on the heart, resulting in heart failure [43,44]. The changes seen in human myocardial infarction closely resemble the pathophysiological and morphological warning signs that isoproterenol causes in animals. The three subfamilies of the MAPK signaling pathway, ERK, JNK, and p38, are stimulated by the elevated generation of free radicals during myocardial infarction [22,24]. When the pathway is activated, NF-κB is upregulated, which increases the production of inflammatory cytokines and eventually leads to myocardial damage [43,44]. Numerous studies have been conducted on the ERK signaling pathway, which is essential for controlling the immunological response as well as cellular survival, development, and death [43]. The role of ERK is to mitigate the likelihood of myocardial infarction and enhance cell survival [44]. Some research has reported the MAPK and NF-κB pathways participation in heart failure, myocardial hypertrophy, and the regulation of blood pressure [43,44]. Research has reported that the MAPK inhibition may result in the 2-Nrf activation, a key factor in the detoxification enzyme expression regulation during the second phase [43-45].

The study showed an environmentally friendly CS-Fe3O4/Au NPs nanocomposite formulation. A range of spectroscopic methods was utilized to characterize the Au NPs, and their efficacy in myocardial infarction treatment was examined.

Here, the protective potentials of CS-Fe3O4/Au NPs nanocomposite were examined in relation to myocardial injury. This was achieved by establishing a myocardial infarction model in mice through the administration of isoproterenol. Additionally, the expression levels of several genes in the MAPK signaling pathway were evaluated to elucidate the mechanism underlying the applied treatment (see Figure 7). The CS-Fe3O4/Au NPs nanocomposite caused a reduction in the levels of p-IKKα/β, p-IkBα, and p-NF-kβ p65, and PPAR/GAPDH. Also, the CS-Fe3O4/Au NPs nanocomposite demonstrated a notable decrease (p<0.01) in the IL6, TNFα, and IL1β mRNA expression, along with a reduction in the number of CD68+ cells (Figures 8-10). The untreated animals demonstrated a myocardial infarction model, characterized by significant collagen accumulation and considerable damage to the heart. In addition, there was an increase in the MAPK expression, which further substantiates the validity of the model. Current studies indicate that several signaling pathways, particularly the MAPK pathway-associated proteins, experience modifications in response to myocardial injury [45,46]. Prior studies have demonstrated that isoproterenol effectively raises MAPK levels [46]. In relation to the control of gene expression and apoptosis, the MAPK signaling pathway is essential, especially when it comes to Bcl2 and Bax. These genes are crucial parts of the apoptotic signaling cascade and are triggered by extracellular cues inside the cell [47]. Furthermore, the start of myocardial infarction causes the production of inflammatory cytokines, which raises MAPK P38 activity [47]. The CS-Fe3O4/Au NPs nanocomposite shows great potential in treating cardiac damage brought on by the injection of isoproterenol. The CS-Fe3O4/Au NPs nanocomposite antioxidant characteristics, along with their constituent compounds, reveal a considerable effect in inhibiting DPPH free radicals. There is little question that raising antioxidant levels strengthens the body’s defenses against a range of chronic illnesses. Antioxidants can reduce the risk of heart failure by altering NF-κB and mitogen-activated protein kinase (MAPK) signaling pathway, according to Martinez et al. (2016) [48]. Therefore, the antioxidative properties of nanoparticles may be related to their potential ability to reduce the expression of MAPK proteins.

Efficacies of CS-Fe3O4/Au NPs on p-NF-kβ p65/NF-kβ p65, PPAR/GAPDH, p-IKKα/β/IKKα/β and p-IkBα/IkBα (Fold change) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Figure 7. Efficacies of CS-Fe3O4/Au NPs on p-NF-kβ p65/NF-kβ p65, PPAR/GAPDH, p-IKKα/β/IKKα/β and p-IkBα/IkBα (Fold change) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Efficacies of CS-Fe3O4/Au NPs on the number of CD68+ cell in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Figure 8. Efficacies of CS-Fe3O4/Au NPs on the number of CD68+ cell in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Efficacies of CS-Fe3O4/Au NPs on the IL1β, IL6 and TNF-α mRNA levels in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Figure 9. Efficacies of CS-Fe3O4/Au NPs on the IL1β, IL6 and TNF-α mRNA levels in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Efficacies of CS-Fe3O4/Au NPs on the IL1β, IL6 and TNFα concentration (pg/mg) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Figure 10. Efficacies of CS-Fe3O4/Au NPs on the IL1β, IL6 and TNFα concentration (pg/mg) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.

Oxidative stress has been established as a catalyst for NF-κB activation, an essential transcription factor that responds to oxidative stress. This signaling pathway plays a vital role in cell differentiation and proliferation, which ultimately contributes to cardioprotective advantages [45]. Also, NF-κB plays a role in the early stages of inflammatory responses and can promote the synthesis of several inflammatory cytokines, such as TNF-α, IL-1, and IL-6. Moreover, NF-κB appears to exert detrimental effects on myocytes [45,46]. Previous studies have shown that NF-κB activation is essential in the development of doxorubicin-induced cardiotoxicity [42,46]. In the present study, the isoproterenol administration was associated with an increase in the NF-κB mRNA expression. Treatment with CS-Fe3O4/Au NPs decreased the expression of mRNA of NF-κB, IL1β, IL6, and TNFα, suggesting that the CS-Fe3O4/Au NPs nanocomposite formulation exerts a dampening effect on the inflammatory response associated with NF-κB. Similarly, a current laboratory investigation involving NPs bio-capped with macroalgae revealed an anti-inflammatory property [42].

Recent studies have demonstrated that CS-Fe3O4/Au NPs nanocomposite resulted in a reduction in cTn-T and ST segment deviation in mice with myocardial infarction, in addition to a lower heart-wet weight/body weight ratio (Figures 11-13). In alignment with our research, Arozal et al. (2022) demonstrated the cardioprotective effects of NPs in cases of myocardial infarction, as evidenced by a reduction in cTn-T in mice [42].

Efficacies of CS-Fe3O4/Au NPs on the concentrations of cTn-T (pg/mL) and cardiac troponin-1 (ng/mL) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Figure 11. Efficacies of CS-Fe3O4/Au NPs on the concentrations of cTn-T (pg/mL) and cardiac troponin-1 (ng/mL) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Efficacies of CS-Fe3O4/Au NPs on MI mice ST segment deviation (mV) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Figure 12. Efficacies of CS-Fe3O4/Au NPs on MI mice ST segment deviation (mV) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Efficacies of CS-Fe3O4/Au NPs on heart wet weight/body weight ratio (mg/g) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.
Figure 13. Efficacies of CS-Fe3O4/Au NPs on heart wet weight/body weight ratio (mg/g) in the C57BL/6 mice with heart failure (p<0.01). * indicate the significance difference (p<0.01) between the untreated group and other experimental groups.

One of the most popular nanocarriers for the delivery of medications that protect the heart is Au NPs. Combining Au NPs with already available medicinal medications has been proposed as a novel strategy with increased potential for treating cardiac conditions. Because of their stability, low toxicity, low immunogenicity, and simplicity of manufacturing, metal nanoparticles have been widely employed in gold nanocarriers [49]. According to reports, clinical medications become more accurate and efficient when they are conjugated. A medication called Simdax has received clinical approval to treat cardiac disease. In rats with doxorubicin-induced heart failure, simdax conjugated to AuNPs shows cardioprotective benefits. Because gold nanoconjugates are more effectively targeted to the damaged tissue, their cardioprotective qualities are greater than those of simdax [50]. The sympathetic nervous system’s hyperactivity in volume-overloaded heart failure is lessened by β-blockers. One of the most used β-blockers is metoprolol, which is conjugated with Au NPs to enhance delivery to the heart tissues. Metoprolol primarily targets β1 receptors, and the conjugates demonstrate twofold efficiency in targeting the volume-overloaded heart failure tissue. Due to their little negative effects on other organs, these conjugates can be used in therapeutic settings [51]. miR155-AuNPs are useful in the treatment of diabetic cardiomyopathy. This condition is frequently observed in postmenopausal women, and estrogen shortage exacerbates its symptoms [52]. In general, the hearts of diabetic mice had more pro-inflammatory type 1 macrophages than anti-inflammatory type 2 macrophages. Furthermore, ovariectomized diabetic mice’s hearts showed increased cardiac hypertrophy, fibrosis, reactive oxygen species generation, and cell death. MiR155-AuNPs conjugates dramatically boost anti-inflammatory type 2 macrophages and reduce inflammation severity when delivered in vivo. It ultimately results in the restoration of heart function by lowering cell apoptosis [53].

Heart tissue engineering is a new therapeutic approach for treating cardiovascular disease (CVD). Tissue regeneration or repair uses a variety of nanomaterial and biomaterial combinations along with engineering techniques. Typically, cardiac regenerative biomaterials use coated electrically active NPs to target hearts. In one study, the biological and functional characteristics of cardiomyocytes were enhanced by the injection of hydrogels made from electrically active gold and laponite NPs filled with extracellular matrix. Extracellular matrix-hydrogel combined with gold or laponite nanoparticles improved heart cell compatibility and the phenotypic development of cardiac-specific proteins [54]. For instance, the aforementioned study’s usage of nanoformulations enhanced the expression of cardiac-specific markers such cTnl, SAC, and Cx43. It demonstrates the powerful uses of these hydrogels in the targeted administration of biologically active substances for infarcted myocardial cardiac tissue engineering. The integration of nanoformulations into cardiac tissues preserves the biomaterials’ electrical conductivity and functional characteristics. These nanoformulations reduce the hydrogel’s porosity features, creating an environment that is conducive to cardiomyocyte growth [54].

Au NPs have shown promise as drug-delivery nanomaterials that don’t harm healthy tissues. Although gold nanoparticles have been utilized in lab settings to treat acute myocardial infarction (AMI), further research and clinical trials are still needed. Cardiomyocyte necrosis and apoptosis, fibroblast proliferation, cardiomyocyte conversion to myofibroblasts, collagen deposition in the myocytes, and cardiac hypertrophy are additional problems that can result from AMI. Heart failure may result from the hypertrophy of cardiomyocytes [55]. All additional issues are further avoided by the favorable effects of gold nanoparticle conjugates or alone in AMI. By preventing cardiomyocyte necrosis and apoptosis, PEGylated Au NPs with a protective coating and a diameter of 10 nm can shrink the size of an infarcted heart [55]. Additionally, they can reduce inflammation by reducing collagen deposition. Therefore, the study recommends treating CVDs with Au NPs alone or their nanoconjugates [56]. Due to their higher cure rates and fewer side effects, photodynamic therapy and sonodynamic therapy are suggested for the treatment. The pathogenic tissues can be targeted and destroyed by certain medications, such as precursors of porphyrins with metal Au NPs produced by photoreduction techniques. These NP compositions damage DNA and produce reactive oxygen species (ROS), which kill cells [37]. Using the photoreduction technique, a team of researchers created metal NPs (either iron oxide or gold) and aminolevulinic acid (porphyrin IX precursor). The selectivity of iron transport across the mitochondrial inner membrane is disrupted by nanohybrids. Because they specifically and efficiently kill macrophages, these nanohybrids serve as a unique diagnostic and treatment approach for CVDs [57].

4. Conclusions

In conclusion, Pd NPs were successfully integrated into Fe3O4 magnetic NPs, which were coated with chitosan in the presence of green tea extract. The prepared CS-Fe3O4/Au NPs were thoroughly characterized using a variety of techniques, including FE-SEM, EDX, FT-IR, TEM, XRD, ICP, and VSM. The TEM image showed a cotton-like appearance, with two different types of particles: the larger, darker Au NPs at the periphery, and the smaller, gray-colored Fe3O4 NPs embedded within. The EDX analysis identified the presence of Fe, Au, C, N, and O elements. The XRD test revealed the cubic patterns of Fe3O4 NPs in the (220), (311), (400), (422), (511), and (440) crystal planes of the Fe3O4 NPs (JCPDS No. 19-0629). This groundbreaking therapy seeks to tackle myocardial infarction in animals, concentrating particularly on the PPAR-γ/NF-κB signaling pathway. Research indicates that CS-Fe3O4/Au NPs nanocomposite effectively reduces the pro-inflammatory cytokine levels. Furthermore, it has been observed that they significantly reduce the myocardial injury marker levels, enhance ventricular wall infarction, and lower mortality rates. The beneficial effects of CS-Fe3O4/Au NPs nanocomposite may be related to the gene expression normalization linked to PPAR-γ/NF-κB/ΙκB-α/ΙΚΚα/β and the phosphorylation of PPAR-γ. The cardioprotective effects of Au NPs on mice with myocardial infarction appear to be more significant in the pre + post-isoproterenol groups than in the post-isoproterenol group. CS-Fe3O4/Au NPs demonstrate cardioprotective properties against myocardial infarction. Following the validation of these findings in clinical trial studies, CS-Fe3O4/Au NPs may be utilized as a remedial agent for the treatment of CVDs especially heart failure following myocardial infarction in humans. Also, it is suggested that the cytotoxicity and potential long-term impacts of CS-Fe3O4/Au NPs are investigated in the in vivo and clinical trial studies.

Acknowledgment

The authors extend their appreciation to the Deanship of Research and Graduate Studies at King Khalid University for funding this work under grant number RGP2/350/46.

  • 1.

    Scientific Research Project of Shanxi Provincial Health Commission (The Funding Number: 2024009)

  • 2.

    Shanxi Provincial Administration of Traditional Chinese Medicine Project (The Funding Number: 2024ZYY2C036)

  • 3.

    Fundamental Research Program of Shanxi Province (The Funding Number: 202203021222340)

  • 4.

    Shanxi Bethune Hospital Talent Introduction Research Fund Project (The Funding Number: 2023RC23)

  • 5.

    Shanxi Provincial Administration of Traditional Chinese Medicine Project (The Funding Number: 2024ZYYC032)

  • 6.

    Fundamental Research Program of Shanxi Province (The Funding Number: 202403021212190)

CRediT authorship contribution statement

Xiaolong Mi, Kaiyi Zhu, Zhijie Yue, Yunxia Ren, Xinjian Li, Jun Lian, Attalla F. El-kott, Heba I. Ghamry, Fatemah E. Alajmi: Visualization, Writing original draft, Formal analysis. Attalla F. El-kott, Heba I. Ghamry, Fatemah E. Alajmi: Funding acquisition, Methodology, Supervision. Attalla F. El-kott, Heba I. Ghamry, Fatemah E. Alajmi: Writing original draft, Formal analysis, Writing-review and editing. All authors reviewed the manuscript.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Declaration of Generative AI and AI-assisted technologies in the writing process

The authors confirm that there was no use of AI-assisted technology for assisting in the writing of the manuscript and no images were manipulated using AI.

References

  1. , , , , , , , . Research progress on animal models of chronic pain and its application in traditional Chinese medicine research. China Journal of Chinese Materia Medica. 2020;45:5866-5876. https://doi.org/10.19540/j.cnki.cjcmm.20200924.201
    [Google Scholar]
  2. , , . Acute myocardial infarction. Lancet (London, England). 2017;389:197-210. https://doi.org/10.1016/S0140-6736(16)30677-8
    [Google Scholar]
  3. , , , , , , , , , . Therapeutic effects of wenxin keli in cardiovascular diseases: An experimental and mechanism overview. Frontiers in Pharmacology. 2018;9:1005. https://doi.org/10.3389/fphar.2018.01005
    [Google Scholar]
  4. , , , , , . Astrocyte elevated gene-1 induces autophagy in diabetic cardiomyopathy through upregulation of KLF4. Journal of Cellular Biochemistry. 2019;120:9709-9715. https://doi.org/10.1002/jcb.28249
    [Google Scholar]
  5. , , , , , , , , , , , , . Monascus pigment-protected bone marrow-derived stem cells for heart failure treatment. Bioactive Materials. 2024;42:270-283. https://doi.org/10.1016/j.bioactmat.2024.08.038
    [Google Scholar]
  6. , , , , , , . Ant colony algorithm-enabled back propagation neural network and response surface methodology based ultrasonic optimization of safflower seed alkaloid extraction and antioxidant. Industrial Crops and Products. 2024;220:119191. https://doi.org/10.1016/j.indcrop.2024.119191
    [Google Scholar]
  7. , , , , , , , , . M2 macrophage exosome-derived lncRNA AK083884 protects mice from CVB3-induced viral myocarditis through regulating PKM2/HIF-1α axis mediated metabolic reprogramming of macrophages. Redox Biology. 2024;69:103016. https://doi.org/10.1016/j.redox.2023.103016
    [Google Scholar]
  8. , , , , , , , . Nanozyme-enhanced tyramine signal amplification probe for preamplification-free myocarditis-related miRNAs detection. Chemical Engineering Journal. 2025;503:158093. https://doi.org/10.1016/j.cej.2024.158093
    [Google Scholar]
  9. , , , , , , . Multitargeted immunomodulatory therapy for viral myocarditis by engineered extracellular vesicles. ACS Nano. 2024;18:2782-2799. https://doi.org/10.1021/acsnano.3c05847
    [Google Scholar]
  10. , , , , , , , , , . Hypoxia-induced signaling in the cardiovascular system: Pathogenesis and therapeutic targets. Signal Transduction and Targeted Therapy. 2023;8:431. https://doi.org/10.1038/s41392-023-01652-9
    [Google Scholar]
  11. , , , . Preliminary study on saliva proteomics of different furs in digestive system diseases. 2009 IEEE International Symposium on IT in Medicine & Education 2009 https://www.doi.org/10.1109/ITIME.2009.5236461
    [Google Scholar]
  12. , , , , , , , , , , , , , , , , , , , , . NF-κB pathway activation during endothelial-to-mesenchymal transition in a rat model of doxorubicin-induced cardiotoxicity. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie. 2020;130:110525. https://doi.org/10.1016/j.biopha.2020.110525
    [Google Scholar]
  13. , , , , , , , , . Calcitonin gene-related peptide inhibits the cardiac fibroblasts senescence in cardiac fibrosis via up-regulating klotho expression. European Journal of Pharmacology. 2019;843:96-103. https://doi.org/10.1016/j.ejphar.2018.10.023
    [Google Scholar]
  14. , , , , , . Xanthohumol inhibits TGF-β1-induced cardiac fibroblasts activation via mediating PTEN/Akt/mTOR signaling pathway. Drug Design, Development and Therapy. 2020;14:5431-5439. https://doi.org/10.2147/DDDT.S282206
    [Google Scholar]
  15. , , , , , , , . The signaling pathways of selected traditional Chinese medicine prescriptions and their metabolites in the treatment of diabetic cardiomyopathy: A review. Frontiers in Pharmacology. 2024;15:1416403. https://doi.org/10.3389/fphar.2024.1416403
    [Google Scholar]
  16. , , , , , , , , , , . The Janus face of mitophagy in myocardial ischemia/reperfusion injury and recovery. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie. 2024;173:116337. https://doi.org/10.1016/j.biopha.2024.116337
    [Google Scholar]
  17. , , , , , , , , . 4D printed cardiac occlusion device with efficient anticoagulation, proendothelialization, and precise localization. Advanced Functional Materials 2025 https://doi.org/10.1002/adfm.202412533
    [Google Scholar]
  18. , , , , , , , , . Enhancing panvascular medicine: Unveiling the nexus of pan-cardio-oncology and expanding therapeutic frontiers. Science Bulletin. 2025;70:798-800. https://doi.org/10.1016/j.scib.2025.01.016
    [Google Scholar]
  19. , , , , , , . Weight status change during four years and left ventricular hypertrophy in Chinese children. Frontiers in Pediatrics. 2024;12:1371286. https://doi.org/10.3389/fped.2024.1371286
    [Google Scholar]
  20. , , , . Acute coronary events. Circulation. 2012;125:1147-1156. https://doi.org/10.1161/CIRCULATIONAHA.111.047431
    [Google Scholar]
  21. , , , , , , , , , . A case of pioneering subcutaneous implantable cardioverter defibrillator intervention in Timothy syndrome. BMC Pediatrics. 2024;24:729. https://doi.org/10.1186/s12887-024-05216-w
    [Google Scholar]
  22. , , , , , . Nanoparticles: promising tools for the treatment and prevention of myocardial infarction. International Journal of Nanomedicine. 2021;16:6719-6747. https://doi.org/10.2147/IJN.S328723
    [Google Scholar]
  23. , , , , , , , , , , . Sedentary behavior and cardiovascular morbidity and mortality: A science advisory from the American heart association. Circulation. 2016;134:e262-e279. https://doi.org/10.1161/CIR.0000000000000440
    [Google Scholar]
  24. , , , , , . The therapeutic potential of nanoparticles to reduce inflammation in atherosclerosis. Biomolecules. 2019;9:416. https://doi.org/10.3390/biom9090416
    [Google Scholar]
  25. , , , . Application of targeted therapy strategies with nanomedicine delivery for atherosclerosis. Acta Pharmacologica Sinica. 2021;42:10-17. https://doi.org/10.1038/s41401-020-0436-0
    [Google Scholar]
  26. , , , . Chemical characterization and anti-breast cancer effects of silver nanoparticles using Phoenix dactylifera seed ethanolic extract on 7,12-Dimethylbenz[a] anthracene-induced mammary gland carcinogenesis in Sprague Dawley male rats. Applied Organometallic Chemistry. 2020;34:e5136. https://doi.org/10.1002/aoc.5136
    [Google Scholar]
  27. , , , , . Falcaria vulgaris leaf aqueous extract mediated synthesis of iron nanoparticles and their therapeutic potentials under in vitro and in vivo condition. Applied Organometallic Chemistry. 2019;33:e5246. https://doi.org/10.1002/aoc.5246.
    [Google Scholar]
  28. , . Gold nanoparticles: Assembly, supramolecular chemistry, quantum-size-related properties, and applications toward biology, catalysis, and nanotechnology. Chemical Reviews. 2004;104:293-346. https://doi.org/10.1021/cr030698+
    [Google Scholar]
  29. , , , , . Gold nanoparticles in chemical and biological sensing. Chemical Reviews. 2012;112:2739-2779. https://doi.org/10.1021/cr2001178
    [Google Scholar]
  30. , , , , . 80% tunneling magnetoresistance at room temperature for thin Al–O barrier magnetic tunnel junction with CoFeB as free and reference layers. Journal of Applied Physics. 2007;101 https://doi.org/10.1063/1.2696590
    [Google Scholar]
  31. , , , , , , , , , , . Noble metal phosphides supported on CoNi metaphosphate for efficient overall water splitting. ACS Applied Materials & Interfaces. 2024;16:8939-8948. https://doi.org/10.1021/acsami.3c19077
    [Google Scholar]
  32. , , , , , . Ultrahigh-performance fiber-supported iron-based ionic liquid for synthesizing 3,4-dihydropyrimidin-2-(1 H)-ones in a cleaner manner. Langmuir : The ACS Journal of Surfaces and Colloids. 2024;40:9579-9591. https://doi.org/10.1021/acs.langmuir.4c00332
    [Google Scholar]
  33. , , , , , . Promising dawn in tumor microenvironment therapy: Engineering oral bacteria. International Journal of Oral Science. 2024;16:24. https://doi.org/10.1038/s41368-024-00282-3
    [Google Scholar]
  34. , , , , , , , . Fabrication of a porous metal-organic framework with polar channels for 5-Fu delivery and inhibiting human osteosarcoma cells. Journal of Chemistry. 2018;2018:1-7. https://doi.org/10.1155/2018/1523154
    [Google Scholar]
  35. , . Uptake of engineered gold nanoparticles into mammalian cells. Chemical Reviews. 2014;114:1258-1288. https://doi.org/10.1021/cr300441a
    [Google Scholar]
  36. , , , , , , , . Biocompatible chitosan/starch/graphene quantum dots/titanium dioxide nanocomposite: A stimuli-responsive, porous nanocarrier for prolonged quercetin delivery in lung cancer treatment. BioNanoScience. 2024;14:2491-2508. https://doi.org/10.1007/s12668-024-01461-6
    [Google Scholar]
  37. , . Molecular mechanism of the photochemical generation of gold nanoparticles in ethylene glycol: Support for the disproportionation mechanism. The Journal of Physical Chemistry. B. 2006;110:14014-14019. https://doi.org/10.1021/jp062972k
    [Google Scholar]
  38. , , , , , . Coupling protein scaffold and biosilicification: A sustainable and recyclable approach for d-mannitol production via one-step purification and immobilization of multienzymes. International Journal of Biological Macromolecules. 2024;269:132196. https://doi.org/10.1016/j.ijbiomac.2024.132196
    [Google Scholar]
  39. , , , , . Gold nanoparticles: A revival in precious metal administration to patients. Nano Letters. 2011;11:4029-4036. https://doi.org/10.1021/nl202559p
    [Google Scholar]
  40. , , . Gold nanoparticles in cardiovascular imaging. Wiley Interdisciplinary Reviews. Nanomedicine and Nanobiotechnology. 2018;10 2018 Jan;10(1). https://doi.org/10.1002/wnan.1470
    [Google Scholar]
  41. , , , . Influencing factors of microscanning performance based on flat optical component. Chinese Optics Letters. 2011;9:052302. https://www.doi.org/10.3788/COL201109.052302
    [Google Scholar]
  42. , , , , , , . Protective effects of silver nanoparticles in isoproterenol-induced myocardial infarction in rats. Frontiers in Medicine. 2022;9:867497. https://doi.org/10.3389/fmed.2022.867497
    [Google Scholar]
  43. , , , , . Mangiferin attenuates myocardial ischemia-reperfusion injury via MAPK/Nrf-2/HO-1/NF- κ B in vitro and in vivo. Oxidative Medicine and Cellular Longevity. 2019;2019:7285434. https://doi.org/10.1155/2019/7285434
    [Google Scholar]
  44. , , , , . Research on cardioprotective effect of irbesartan in rats with myocardial ischemia-reperfusion injury through MAPK-ERK signaling pathway. European Review for Medical and Pharmacological Sciences. 2019;23:5487-5494. https://doi.org/10.26355/eurrev_201906_18218
    [Google Scholar]
  45. , , , , , , , , . Inhibition of Rho-kinase protects the heart against ischemia/reperfusion injury. Cardiovascular Research. 2004;61:548-558. https://doi.org/10.1016/j.cardiores.2003.12.004
    [Google Scholar]
  46. , , , . The effect of 6 weeks of high intensity interval training (HIIT) with nano-curcumin supplementation on factors related to cardiovascular disease in inactive overweight girls. Feyz. 2020;24:181-189. https://doi.org/10.18502/ijdo.v11i3.2606
    [Google Scholar]
  47. , , , , , . IL-10 inhibits inflammation and attenuates left ventricular remodeling after myocardial infarction via activation of STAT3 and suppression of HuR. Circulation Research. 2009;104:e9-18. https://doi.org/10.1161/CIRCRESAHA.108.188243
    [Google Scholar]
  48. , , , , , , , , , , , , , , . Modulation of MAPK and NF-κB signaling pathways by antioxidant therapy in skeletal muscle of heart failure rats. Cellular Physiology and Biochemistry. 2016;39:371-384. https://doi.org/10.1159/000445631
    [Google Scholar]
  49. , , . Conjugating existing clinical drugs with gold nanoparticles for better treatment of heart diseases. Frontiers in Physiology. 2018;9:642. https://doi.org/10.3389/fphys.2018.00642
    [Google Scholar]
  50. , , , , , . Development and testing of gold nanoparticles for drug delivery and treatment of heart failure: A theranostic potential for PPP cardiology. The EPMA Journal. 2013;4:20. https://doi.org/10.1186/1878-5085-4-20
    [Google Scholar]
  51. , , , , , , , , , , . Bisoprolol reversed small conductance calcium-activated potassium channel (SK) remodeling in a volume-overload rat model. Molecular and Cellular Biochemistry. 2013;384:95-103. https://doi.org/10.1007/s11010-013-1785-5
    [Google Scholar]
  52. , , , , , , , . Insulin resistance and risk of cardiovascular disease in postmenopausal women. Circulation: Cardiovascular Quality and Outcomes. 2015;8:309-316. https://doi.org/10.1161/circoutcomes.114.001563
    [Google Scholar]
  53. , , , , , , , , , . Gold nanoparticle-based miR155 antagonist macrophage delivery restores the cardiac function in ovariectomized diabetic mouse model. International Journal of Nanomedicine. 2017;12:4963-4979. https://doi.org/10.2147/IJN.S138400
    [Google Scholar]
  54. , , , , , . Novel preparation of Au nanoparticles loaded Laponite nanoparticles/ECM injectable hydrogel on cardiac differentiation of resident cardiac stem cells to cardiomyocytes. Journal of Photochemistry and Photobiology. B, Biology. 2019;192:49-54. https://doi.org/10.1016/j.jphotobiol.2018.12.022
    [Google Scholar]
  55. , , . Reversible cardiac hypertrophy induced by PEG-coated gold nanoparticles in mice. Scientific Reports. 2016;6:20203. https://doi.org/10.1038/srep20203
    [Google Scholar]
  56. , , , , , , , , . Polyethylene-glycol-coated gold nanoparticles improve cardiac function after myocardial infarction in mice. Canadian Journal of Physiology and Pharmacology. 2018;96:1318-1327. https://doi.org/10.1139/cjpp-2018-0227
    [Google Scholar]
  57. , , , . Synthesis and characterization of aminolevulinic acid with gold and iron nanoparticles by photoreduction method for non-communicable diseases diagnosis and therapy. Journal of Materials Science Materials in Electronics. 2019;30:16789-16797. https://doi.org/10.1007/s10854-019-01337-6
    [Google Scholar]

Fulltext Views
1,474

PDF downloads
2,338
View/Download PDF
Download Citations
BibTeX
RIS
Show Sections

Suggested read for related articles: