Translate this page into:
Engineering modified manganese dioxide nanozymes with neuroprotective properties for potential stroke therapy
*Corresponding authors: E-mail addresses: zqreadmore@163.com (Q. Zhou), hongzao1980@gmail.com (H. Ni)
-
Received: ,
Accepted: ,
Abstract
We developed lactoferrin (Lf)-coated MnO2 nanozymes loaded with insoluble resveratrol (RVL) to enhance blood-brain barrier (BBB) penetration and targeted drug delivery. The MnO2@RVL@Lf nanozymes (20–60 nm) exhibited drug-loading efficiency of 52.4% in 40 μg∙mL-1 RVL concentrations, controlled RVL release (69.8% under hypoxia), and oxygen generation (10.1 mg∙mL-1). In vivo studies demonstrated reduced brain malondialdehyde (16.56 vs. 21.30 for RVL alone) without systemic toxicity, as evidenced by stable liver/kidney enzymes [Lactate dehydrogenase (LDH), Aspartate aminotransferase (AST), Alanine aminotransferase (ALT), and Alkaline phosphatase (ALP)] and preserved organ histology. The nanozymes also downregulated pro-inflammatory factors [Tumor necrosis factor-alpha (TNF-α), Interleukin-2 beta (IL-2β), Matrix metalloproteinase-9 (MMP-9)] while upregulating anti-inflammatory IL-10, promoting neuroregeneration. Improved motor function, learning, and reduced cerebral edema further confirmed therapeutic efficacy. Overall, MnO2@RVL@Lf nanozymes mitigate ischemic stroke damage by combating oxidative stress, suppressing inflammation, and protecting neurons, highlighting their potential for stroke therapy.
Keywords
Characterization
Function
Nanozymes
Synthesis

1. Introduction
Cerebral ischemia, responsible for 87% of all strokes, claims ∼15 million lives annually due to insufficient blood flow in the major cerebral arteries and subsequent oxygen deprivation [1]. Under ischemic conditions, microglia, the brain’s resident immune cells, become activated to protect neurons [2]. However, their excessive activation can exacerbate neuronal death by releasing pro-inflammatory cytokines such as interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) [2]. Additionally, the lack of blood supply triggers a surge in reactive oxygen species (ROS), including hydrogen peroxide, and amplifies oxidative damage via incomplete lipid peroxidation at the cellular level [3]. These pathological changes often result in impaired consciousness, cognitive deficits, and even death. Consequently, therapeutic strategies targeting oxidative stress and inflammation are critical. However, the blood-brain barrier (BBB) poses a major obstruction in selecting and delivering effective drugs to mitigate these effects.
Resveratrol (RVL; 3,5,4′-trihydroxystilbene), a polyphenolic phytoalexin, has gained significant attention for its antiplatelet, anti-inflammatory, and antioxidant properties, particularly in the context of neurological disorders [4]. Despite its poor water solubility, low bioavailability, and limited BBB permeability, RVL has demonstrated therapeutic efficacy in conditions such as Parkinson’s disease and stroke [5]. To overcome these limitations, researchers are actively exploring RVL-loaded nanocarriers, which not only enhance targeted drug delivery but also improve BBB penetration. Notably, nanoformulated RVL or nanocarrier-based delivery systems have been shown to increase drug release efficiency by 800- to 3000-fold compared to free RVL, highlighting its immense potential for neuroprotection in ischemic stroke [6].
The development of multifunctional nanoparticles capable of crossing the BBB, scavenging free radicals to mitigate oxidative stress, alleviating hypoxia by balancing ROS elimination and O2 generation, and enabling stimuli-responsive drug release has driven significant interest in nanozymes [7,8]. Among these, MnO2-based nanozymes have emerged as a promising platform due to their triple-enzyme-mimetic activity (catalase, peroxidase, and superoxide dismutase), which establishes a critical equilibrium between radical scavenging and O2 production, a key therapeutic mechanism for preventing neuronal damage in brain disorders [1,9,10]. However, while MnO2 nanozymes loaded with neuroprotective drugs show efficacy in the acute phase of stroke (when BBB permeability is elevated), their delivery is hindered as the BBB gradually restores its integrity. To overcome this limitation, targeted BBB-crossing strategies, such as surface modification with lactoferrin, transferrin, or viral peptides [1,11,12], are being explored. Notably, lactoferrin is particularly advantageous due to [1]:
-
It has hydrogen-bonding affinity with MnO2 nanozymes, facilitating stable conjugation.
-
The abundance of lactoferrin receptors on the BBB enhances active transport.
-
It’s pH-sensitive drug release in the ischemic brain (where tissue pH drops below 7), acting as an acid-responsive gate for precise delivery.
In this study, we developed multifunctional MnO2@RVL@Lf nanozymes designed to achieve dual objectives: (1) targeted delivery of RVL and (2) mitigation of oxidative stress in cerebral ischemia. The nanozymes were synthesized via a green approach using cumin extract, followed by surface modification with lactoferrin (Lf) to enable BBB-targeted drug release. This advances beyond previous Lf/transferrin-MnO₂ nanozymes by not only targeting the brain but also providing a combined anti-oxidant and anti-inflammatory attack, where O₂ generation ameliorates hypoxia while RVL quenches residual oxidative stress. Furthermore, it surpasses conventional RVL carriers by adding this catalytic, hypoxia-responsive function. This multi-modal mechanism, simultaneous oxygen supply, controlled drug release, and targeted delivery, enables a comprehensive therapeutic outcome, achieving enhanced neuroprotection and functional recovery unattainable by single-mechanism systems. Key findings demonstrated the MnO2@RVL@Lf nanozyme’s exceptional dispersion stability under physiological conditions and MnO2 nanozyme’s high biocompatibility with normal NIH3T3 cells. Notably, the MnO2@RVL@Lf nanozymes exhibited pronounced cytoprotective effects, promoting neuronal growth even under oxidative stress. In vivo studies using a rat stroke model demonstrated that Nanozyme Theta outperformed free RVL treatment, showing substantially greater recovery of neurobehavioral function and a pronounced reduction in neuroinflammatory markers within brain tissue. Remarkably, MnO2@RVL@Lf nanozymes exhibited no detectable toxicity while inducing striking tissue restoration, with treated ischemic regions showing near-normal histological architecture compared to damaged controls. These findings position MnO2@RVL@Lf nanozymes as both a neuroprotective and neurorestorative agent for stroke treatment. These results underscore the MnO2@RVL@Lf nanozymes’ potential as a safe and effective therapeutic strategy for ischemic stroke, combining targeted drug delivery, ROS scavenging, and neuroprotection.
2. Materials and Methods
2.1. Green synthesis of MnO2@Lf@RVL nanoparticles
A hydrodistillation protocol was employed to extract cuminum cyminum [13]. Briefly, 100 g of dried cumin seeds (≥99% purity) were mechanically ground and subjected to hydrodistillation using a Clevenger apparatus. The seeds were refluxed in 500 mL of deionized water for 4 h at 100°C, and the resulting vapor was condensed using a recirculating chiller (4°C). The aqueous extract was collected, filtered through a 0.22 μm membrane, and stored at 4°C to preserve its bioactive integrity.
The MnO2 nanozymes synthesis was initiated by dissolving 1.41 g of KMnO4 (Sigma-Aldrich, ≥99%) in 60 mL of deionized water under magnetic stirring (100 rpm) at 50°C. To this solution, 10 mL of freshly prepared cumin extract was added dropwise (1 mL∙min-1) using a peristaltic pump, facilitating controlled reduction of Mn7+ to Mn4+. The reaction proceeded for 3 h under continuous stirring, yielding a dark brown colloidal suspension indicative of MnO2 nanozymes formation. The colloidal product was transferred to a borosilicate Petri dish and dried in a vacuum oven at 80°C for 12 h to remove residual moisture. The resulting powder was then calcined in a programmable muffle furnace under static air conditions. A gradient thermal protocol was applied: (1) Ramp rate: 5°C/min, (2) Final temperature: 400°C, and (3) Holding time: 3 h. This step ensured the formation of crystalline MnO2 nanoparticles with high phase purity.
To load RVL, 50 mg of MnO2 nanozymes was dispersed in 10 mL of a dimethyl sulfoxide (DMSO; Sigma-Aldrich, trans form) solution containing 40 mg of RVL. The mixture was gently agitated for 24 h. Subsequently, the resulting MnO2@ RVL nanozymes were air-dried at room temperature for 24 h, followed by washing with phosphate-buffered saline (PBS) for further use.
To enhance biocompatibility, the MnO2@RVL nanozymes were functionalized with lactoferrin (Lf; Sigma-Aldrich, ≥85%) using a physisorption approach. 50 mg of MnO2@RVL nanozymes were dispersed in 10 mL of PBS (pH 7.4) via probe sonication (20 kHz, 5 min, 30% amplitude). 500 μL of Lf solution (5 mg∙mL-1 in PBS) was introduced dropwise, and the mixture was incubated at 25°C for 12 h under gentle orbital shaking (50 rpm). The MnO2@RVL@Lf conjugate was isolated by high-speed centrifugation (10,000 rpm, 5 min, 4°C) and washed thrice with deionized water to remove unbound Lf. The final product was lyophilized (−80°C, 0.01 mBar, 48 h) and stored at −20°C.
2.2. MnO2@RVL@Lf nanozymes characterization
The surface morphology of MnO2@RVL@Lf nanozymes was analyzed using scanning electron microscopy (SEM; MIRA3, TESCAN). High-resolution transmission electron microscopy (HR-TEM; JEOL, Japan, 200 kV) was employed to examine their internal structure and crystallinity. Dynamic light scattering (DLS; Malvern Zetasizer) determined the hydrodynamic size and zeta potential at 25°C. Thermogravimetric analysis (TGA; Perkin-Elmer TGA-7, N₂ atmosphere, 70–450°C, 5°C/min) assessed organic content and drug loading capacity. The crystalline phase was investigated by X-ray diffraction (XRD; Rigaku D/max, Cu Kα, 20°–70°, 0.02° step, 2°/min). Elemental composition and distribution were analyzed via energy-dispersive X-ray spectroscopy (EDS) and elemental mapping (JEOL JEM2010, 100 kV). Finally, peroxidase-like activity was tested using a UV-vis spectrophotometer by monitoring TMB oxidation.
2.3. Drug loading and release
To determine the loading capacity, 100 μg of MnO2 nanozymes was incubated in a drug solution (2% DMSO) containing varying concentrations of RVL (20, 40, 60, 80, and 100 μg) for 24 h at room temperature under gentle shaking (100 rpm). After incubation, the MnO2@RVL nanozymes were separated by centrifugation (10,000 rpm, 5 min), washed with phosphate-buffered saline (PBS), and the supernatant was collected. The RVL concentration in the supernatant was analyzed by fluorescence spectroscopy (Hitachi F-2500 spectrometer) and compared to the initial solution using Eq. 1 to calculate the loading efficiency. The loading efficiency % (LE, Eq. 1) was calculated using = [(C₀ − Cₑ) / C₀] × 100, where C₀ and Cₑ are the initial and equilibrium concentrations of RVL, respectively.
The RVL release profile from MnO2@RVL@Lf nanozymes was investigated in PBS (pH 7.2) under physiological conditions (37°C, 150 rpm). At predetermined time intervals (0.75, 1.5, 3, 6, 9, 18, and 36 hrs), 2 mL aliquots were collected and immediately replaced with fresh PBS to maintain sink conditions. The released RVL was quantified by measuring absorbance at 306 nm using UV-vis spectrophotometry. Cumulative RVL release was calculated according to Eq. (1):
Where: Ci = concentration of RVL released at the i-th time point (μg/mL), V= sample volume withdrawn (2 mL), Cn = drug concentration at nth measurement (μg/mL), Vs = remaining volume of release medium (mL), Mtotal = total drug content in nanoparticles (μg).
2.4. O2 production assay, peroxidase-/catalase-like activities assay
The catalytic O2 production capability of MnO2-based nanozymes was evaluated in aqueous solution using a portable dissolved oxygen meter (Seven2GO pro S9 DO, Mettler Toledo). Briefly, 100 μg/mL of MnO2 nanozymes or MnO2@RVL@Lf nanozymes were dispersed in 10 mL of sodium acetate buffer containing 200 μL of 30% H2O2. The dissolved oxygen concentration (mg/mL) was recorded at 0, 18, 37, 75, 150, 300, 600, and 900 s to monitor real-time O2 evolution.
The peroxidase-like activity of the MnO₂ and MnO₂@RVL@Lf nanozymes was evaluated by monitoring the oxidation of 3,3′,5,5′-tetramethylbenzidine (TMB). The reaction mixture contained 2 μL of nanozyme (100 μg/mL), 2 μL of TMB (20 mg/mL), and 2 μL of H₂O₂ (30%) in 500 μL of sodium acetate buffer (pH 6.5). After incubation in darkness for 10 min, the absorbance of the oxidized TMB product was measured using a UV–vis spectrometer (Shimadzu UV-2600).
The catalase-mimicking activity of the nanozymes was determined by directly monitoring the decomposition of H₂O₂ via its characteristic absorbance at 240 nm. Briefly, a reaction mixture containing nanozymes (MnO₂ or MnO₂@RVL@Lf, 20 µg/mL) and H₂O₂ (20 mM) in PBS buffer (1 mL, pH 6.5) was incubated at 37°C for 10 min. The concentration of residual H₂O₂ was quantified by measuring the absorbance at 240 nm (A₂₄₀).
2.5. In-vitro trials
2.5.1. Cell culture
NIH 3T3 fibroblasts and PC12 cells (Cell Bank of Chinese Academy of Sciences) were maintained in DMEM (Gibco) supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin (all from Gibco) at 37°C in a humidified 5% CO2 atmosphere.
2.5.2. Cell viability
The cytocompatibility and proliferative effects of MnO2@RVL@Lf nanozymes on normal cell (NIH 3T3) and PC12 cells were evaluated using MTT assay. NIH3T3 cells were seeded in 96-well plates (104 cells/well) in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin, then cultured at 37°C under 5% CO₂ for 24 h. Then, MnO2@RVL@Lf nanozymes was added at concentrations ranging from 5-25 µg/mL and incubated for 24 h. For PC12 cells, 104 cells/mL were seeded under similar conditions. After treatment with RVL, MnO2, and MnO2@RVL@Lf at varying concentrations, cells were exposed to hypoxic conditions (5% O2) for 24 h to evaluate hypoxia-dependent responses. After treatment, NIH3T3 and PC 12 cells were exposed to MTT solution (1 mg∙mL-1 in PBS) for 4 h. The formazan crystals were dissolved in DMSO, and absorbance was measured at 570 nm using a microplate reader (Expert 96, Asys Hitch). Cell viability was calculated relative to untreated controls using Eq. (2).
Where: Asample = Absorbance of cells treated with nanozymes, Acontrol = Absorbance of untreated cells, and Ablank = Absorbance of medium-only wells.
2.6. In-vivo trials
2.6.1 Animal and design experiment
Male Wistar rats (weighing 170–200 g) were housed under controlled conditions with a 12:12-h light-dark cycle and a constant room temperature of 25 ± 1°C. The animals were provided with standard commercial chow and ad libitum access to water throughout the acclimatization and experimental periods. The animal experimental operations were approved by the Animal Care Committee of the First Affiliated Hospital of Wenzhou Medical University (Zhejiang, China). In the following, focal cerebral ischemia was induced via transient right middle cerebral artery occlusion (MCAO), following the method of Longa, et al. [14] with minor modifications. Briefly, rats were anesthetized intraperitoneally with chloral hydrate (400 mg∙kg-1, i.p.). A 4–0 silicon-coated nylon monofilament (Doccol, Sharon, MA, USA) was introduced into the internal carotid artery and advanced to occlude the origin of the middle cerebral artery (MCA). After 2 h of ischemia, the filament was withdrawn to permit reperfusion. Throughout the procedure and recovery period, body temperature was maintained at 37 ± 0.5°C using a heating pad to minimize hypothermia-induced neuroprotection.
Male Wistar rats (n=24) were randomly allocated into four experimental cohorts (n=6/group) using computer-generated randomization: (a) naive control: received vehicle administration only, (b) RVL monotherapy: administered 5 μg/mL RVL (intravenous), (c) nanozyme therapy: treated with 10 μg/mL MnO₂@RVL@Lf nanocomplex (i.v.), and stroke control: subjected to MCAO without therapeutic intervention.
2.6.2. Enzyme analysis
At the experimental endpoint, venous blood samples were collected via tail vein puncture into sterile serum separator tubes. Following a 30-min clotting period at room temperature, samples were centrifuged at 3,000 × g for 15 min (4°C) to obtain serum. Biochemical profiling was performed using a MIRA COBAS autoanalyzer (Roche Diagnostics) to quantify: aspartate aminotransferase (AST), Alanine aminotransferase (ALT), Alkaline phosphatase (ALP), and lactate dehydrogenase (LDH). All assays were conducted using commercial enzymatic kits (Shanghai Keaibo Biotechnology Co., Ltd, China) following International Federation of Clinical Chemistry (IFCC) standardized protocols. Enzyme activities were expressed in international units per liter (U/L).
After deep anesthesia, the brains were quickly taken out and rinsed with cold phosphate-buffered saline (PBS) to check malondialdehyde (MDA) levels. The tissues were then frozen in liquid nitrogen and stored at −80 °C until testing. On the test day, the frozen samples were weighed and mixed with cold PBS at a 1:10 ratio. The mixtures were spun at 14,000×g for 15 min at 4 °C. The clear liquid (supernatant) was collected and used to measure MDA. 100 μL of the supernatant was mixed with 900 μL of distilled water in a test tube. Then, 500 μL of thiobarbituric acid (TBA) reagent was added, and the mixture was heated in a boiling water bath for 60 min. After cooling, tubes were centrifuged at 4000×g for 10 min. The absorbance of the supernatant was measured at 534 nm using a UV1600 spectrophotometer.
2.6.3. Behavioural test
Behavioral assessments were conducted on days 2, 4, and 6 using the Morris water maze and open field tests. For the Morris water maze, a circular pool (160 cm diameter) was equipped with spatial cues and a hidden platform submerged 1–2 cm below the water surface. During the learning phase, rats were allowed to observe the platform for approximately 30 s. In the open field test, rats were released in a square arena measuring 80 cm × 80 cm × 50 cm and monitored for 2 min. Parameters were analyzed: the number of squares crossed, total movement duration, and frequency of rearing (upright posture).
2.6.4. Effect of nanozymes on inflammatory cytokine
To explore inflammatory cytokines, total RNA was extracted from drug-treated cerebral tissues using Trizol reagent (Sinaclon Bio Science, Iran). RNA concentration and purity were measured by Nanodrop spectrophotometry (Thermo Fisher Scientific, USA), followed by DNase I treatment to eliminate genomic DNA. cDNA synthesis was performed using the BONmiR™ miRNA qRT-PCR Detection Kit (china) according to the manufacturer’s instructions. Quantitative real-time PCR was conducted on an ABI PRISM 7500 system (Applied Biosystems, USA) using Power SYBR® Green Master Mix. Cycling conditions were: 95°C for 5 min, then 40 cycles of 95°C for 5 s and 60°C for 30 s. β-Actin served as the reference gene. Relative mRNA expression was calculated using the 2−ΔΔCT method. All reactions were run in triplicate. Primer sequences are in Table 1.
| Gene | Product size | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|---|
| TNFα | 419bp | CTCAAAACTCGAGTGACAAGC | CCGTGATGTCTAAGTACTTGG |
| IL-1β | 227bp | GTGATGTTCCCATTAGACAGC | CTTTCATCACACAGGACAGG |
| IL-2 | 164bp | TGCCTGAAAATGAACTCGG | CTGGCTCATCATCGAATTGG |
| MMP-9 | 258bp | CTTCTGGCGTGTGAGTTTCCA | ACTGCACGGTTGAAGCAAAGA |
| GAPDH | 131bp | AGTTCAACGGCACAGTCAAGG | AGACTCCACGACATACTCAGC |
2.6.5. Histological analysis
Tissue samples of liver, kidney, and brain were fixed in 10% neutral buffered formalin, processed through graded ethanol series, paraffin-embedded, and sectioned at 5 µm thickness. Sections were stained with hematoxylin and eosin (H&E) and examined using a Zeiss light microscope equipped with a KECAM digital camera system.
2.7. Statistical analysis
All data were analyzed using SPSS 19.0 (IBM) and expressed as mean ± SD (n=3). Statistical significance was determined by one-way/two-way ANOVA followed by Tukey’s post-hoc test, with significance levels set at *p<0.05, **p<0.01, and ***p<0.001.
3. Results and Discussion
3.1. Morphological and structural properties
The successful synthesis and structural integrity of the MnO₂@RVL@Lf nanozymes were unequivocally confirmed through a multi-technique analytical approach (Figure 1). The SEM image (Figure 1a) reveals the surface morphology of the MnO2 nanozymes at a magnification of 200 kx. The NPs exhibit a well-defined, uniform structure with an average size in the 25-50 nm range (∼35 nm). The TEM data (Figure 1b) further corroborates the nanoscale morphology, with a wave field of 1.04 μm. Further insights into the nanoscale architecture were provided by TEM (Figure 1b). The images confirmed a spherical morphology, in agreement with our SEM data and prior literature [15], while also revealing a moderate degree of aggregation that slightly increases the apparent particle size. Crucially, the absence of distinct phase boundaries and the homogeneous contrast across the particles provide direct visual evidence for the successful and uniform conjugation of RVL and Lf onto the MnO₂ core, forming a coherent composite structure. The hydrodynamic profile of the nanozymes in solution, as determined by DLS (Figure 1c), is critical for predicting their biological behavior and drug delivery application [16]. The data show a predominant, monomodal distribution centered at 20–80 nm (∼40 nm, PDI = 0.201), underscoring the colloidal stability and monodisperse nature of the formulation. The slight increase in hydrodynamic size compared to the dry-state TEM measurements is attributed to the solvation layer, a characteristic feature of nanoparticles in suspension. This well-defined nanoscale size, combined with low polydispersity, is a key determinant for efficient cellular uptake and biodistribution, positioning our nanozymes as highly promising candidates for targeted drug delivery [16,17].

- (a) SEM image of MnO2 nanoparticles. (b) TEM image of MnO2@RVL@Lf nanozymes. (c) Size distribution profile of MnO2@RVL@Lf nanozymes. (d) Zeta potential measurements of MnO2 and MnO2@RVL@Lf nanozymes.
The zeta potential measurements (Figure 1d) assess the colloidal stability of the NPs. The MnO2@RVL@Lf NPs exhibit a high negative zeta potential (around -37 mV for MnO2 and -22 mV for MnO2@RVL@Lf), suggesting excellent electrostatic repulsion and stability in suspension. This property is crucial for preventing aggregation and ensuring prolonged shelf-life in biological applications [15,16].
3.2. Chemical characterization of MnO2 and MnO2@RVL@Lf
The thermal stability and compositional integrity of the MnO₂@RVL@Lf nanozymes were quantitatively assessed by TGA (Figure 2a). The thermogram reveals a three-stage decomposition profile that provides direct evidence of the composite’s layered architecture. The initial mass loss of ∼11% below 150°C is ascribed to the evaporation of surface-adsorbed water. The subsequent major decomposition event (35.1% mass loss between 150–400°C) is unambiguously attributed to the oxidative combustion of the organic constituents, RVL (20.5%) and Lf (14.6%). This step serves as a quantitative measure of the successful bio-functionalization. Above 400°C, the profile plateaus, indicating the exceptional thermal resilience of the remaining MnO₂ core. Critically, the MnO₂@RVL@Lf construct demonstrated a significantly higher residual mass than its MnO₂@RVL counterpart, a finding we attribute to the protective, stabilizing effect of the lactoferrin coating. This thermal profile confirms the successful incorporation of both organic components while maintaining the structural integrity of the MnO2 nanozymes at elevated temperatures, consistent with the findings of Jain, et al. [18]. Enhanced thermal robustness is a vital attribute for nanozymes intended for therapeutic applications that may involve internal physiological stresses.

- (a) TGA of MnO2, MnO2@RVL (RVL: resveratrol) and MnO2@RVL@Lf (Lf: lactoferrin) nanozymes, and their weight loss between 50 and 400°C heating. (b) XRD patterns of the synthesized MnO2, MnO2@RVL and MnO2@RVL@Lf nanozymes. (c) EDS and (d) element mapping of MnO2@RVL@Lf nanozymes.
The crystalline structure and successful surface modification of the nanozymes were probed by XRD (Figure 2b). The pattern is characterized by broad reflections, a hallmark of bio-templated nanomaterials that incorporate amorphous organic layers [19]. The identifiable peaks at 2θ = 20.96°, 26.24°, 28.88°, 36.88°, 42.56°, 51.20°, 60.40°, and 65.28° align precisely with the orthorhombic phase of MnO₂ (ICDD 96-900-3477), confirming a high degree of phase purity in the inorganic core. The successful functionalization is evidenced by two key observations: a distinct shift in the intensity of the primary MnO₂ peaks and the emergence of new reflections at 2θ = 33.19° and 63.84°. These crystallographic modifications signify a tangible interaction between the MnO₂ lattice and the organic coatings, likely mediated by surface adsorption or coordination bonding. The presence of minor impurity peaks at 2θ = 47.44° and 57.19°, consistent with plant-derived capping agents [20], further validates the green synthesis route.
To conclusively verify the elemental makeup and spatial distribution of components, we performed EDX spectroscopy and elemental mapping (Figures 2c, d). Quantitative analysis established Mn as the predominant element (60.7 wt%), unequivocally confirming the formation of the MnO₂ core. The significant presence of carbon (12.2 wt%) and nitrogen (8.5 wt%) provides definitive chemical evidence for the successful incorporation of the RVL and Lf organic layers. Most compellingly, the elemental maps (Figure 2d) reveal a homogeneous, co-localized distribution of Mn, C, N, and O across the nanozyme architecture. This spatial uniformity is a critical indicator of a coherent composite material, rather than a physical mixture, and ensures consistent functional performance. These findings on composition and distribution are in strong agreement with reports by Zou, et al. [1], Sun, et al. [17] and da Silva, et al. [15] on bio-functionalized manganese oxide systems, solidifying the reliability of our synthesis approach.
3.3. Drug loading and release
The MnO2 nanozymes (100 µg∙mL-1) demonstrated remarkable RVL loading capacity, achieving 74.79±3.56% (20 μg∙mL-1 RVL concentrations) and 52.41±4.87% efficiency at (40 μg∙mL-1 RVL concentrations), respectively Figure (3a,b). TGA quantification revealed a payload of 20.15 μg RVL per 100 μg nanozymes (Figure 2a). Two independent analytical techniques include of (a) Zeta potential shifted from -37 to -22 mV (Figure 1b, d) Characteristic XRD peak attenuation (Figure 3b) and confirmed successful drug conjugation. Hence, this multifunctional platform, in line with the findings of Sun, et al. [17]., optimizes therapeutic delivery while minimizing carrier consumption, establishing MnO2 as a promising Nano vehicle for precision medicine applications. Furthermore, the drug release kinetics of the MnO₂@RVL@Lf nanoplatform were systematically investigated under different physiological conditions to evaluate its pH- and ROS-responsive behavior. As illustrated in Figure 3(c), the cumulative release of RVL over 38 h demonstrated a clear dependence on both environmental pH and the presence of H₂O₂. Hypoxic conditions significantly enhanced RVL release (69.84±6.43% vs 34.20±4.52% over 36 h, p < 0.01), demonstrating two distinct phases: an initial burst release (32.29±4.26% increase within 6 h, p<0.01) attributed to surface-adsorbed drug dissociation, followed by sustained release. Most notably, the combination of an acidic pH (6.5) and a high H₂O₂ concentration resulted in the most RVL release up to 84.46±5.78%. This synergistic effect confirms the dual-responsive nature of the MnO₂@RVL@Lf construct: The MnO₂ shell rapidly decomposes in the presence of H₂O₂ to generate O2 and Mn2⁺ ions, simultaneously disrupting the nanostructure and facilitating the efficient release of the therapeutic payload in response to the hallmark conditions of the ischemic stroke microenvironment. This oxygen-responsive behavior suggests therapeutic potential for hypoxia-associated pathologies [21]. The time-dependent release profile combines immediate drug availability with prolonged action, while the hypoxia-triggered enhancement enables targeted delivery to ischemic microenvironments [17].

- (a) Standard absorption curve of RVL (resveratrol) in different concentrations. (b) Drug loading and its efficiency. (c) Quantitative analyses of RVL release at 37°C at different pH 6.5 and 7.2 with and without H2O2.
3.4. Catalytic activity
Our findings demonstrate that the MnO₂@RVL@Lf nanozyme is engineered to strategically intervene at multiple critical points in the pathological cascade of ischemic stroke, functioning as a sophisticated, self-adapting neuroprotective agent. The dual catalase- and peroxidase-like activities are not merely concurrent functions but are hypothesized to operate in a spatially and temporally controlled sequence to mitigate oxidative stress and reperfusion injury.
The robust catalase-like activity, quantitatively confirmed by significant O₂ generation, is the first line of defense. In the acutely ischemic penumbra, the salvageable tissue region where hypoxia is a primary driver of neuronal death, the nanozyme’s ability to catalyze 2H₂O₂ → 2H₂O + O₂ is critically therapeutic. By converting the overproduced H₂O₂ into life-sustaining oxygen, our system directly targets the core pathology of hypoxia. This in-situ oxygen generation can potentially prolong the survival of neurons in the penumbra, extending the therapeutic window for intervention [22]. As shown in Figure 4a, the slight attenuation of this activity in the final MnO₂@RVL@Lf construct (10.1 mg/mL vs. 15.9 mg/mL for bare MnO₂) is an anticipated outcome of the biocompatible coating, which is essential for blood-brain barrier traversal and overall pharmacokinetics, without compromising the critical therapeutic threshold.

- (a) Schematic view and O2 generation in H2O2 solution with nanozymes, MnO2 and MnO2@RVL@Lf nanozymes. (b) Peroxidase-like activities of MnO2 and MnO2@RVL@Lf nanozymes. (c) Catalase-like activities of MnO2 and MnO2@RVL@Lf nanozymes. (d) Viability assay of NIH 3T3 at different concentrations of MnO2 nanozymes. (e) Optical microscopy images of PC12 cells treated with control, hypoxia, RVL (2.5 µg), MnO2 nanozymes (10 µg∙mL-1), and MnO2@RVL@Lf nanozymes (10 µg∙mL-1). (f) Viability assay of PC12 cells under hypoxia at different concentrations of RVL, MnO2, and MnO2@RVL@Lf nanozymes. Ns: non-significance, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 for a difference between treatment groups. a,b,c,d,e. Least square means with different letters in superscripts are different at *P < 0.05.
Beyond oxygen supply, the catalase-like activity performs a crucial second function: preemptive neuroprotection. By scavenging the abundant H₂O₂ in the ischemic territory, the nanozymes directly deplete the substrate for metal-catalyzed Fenton reactions, thereby preventing the formation of highly destructive hydroxyl radicals (•OH) at their source [23]. This proactive reduction of the overall oxidative load is a fundamental mechanism to protect lipids, proteins, and DNA from oxidative degradation.
However, the therapeutic innovation of our nanozyme lies in its dynamic, responsive nature. The initial suppression of the peroxidase-like activity by the intact Lf/RVL coating is a key safety feature, preventing undesirable •OH generation during circulation and transit to the brain. The subsequent restoration of this activity upon Lf degradation and RVL release is a programmed response to the pathological microenvironment (Figure 4b). We hypothesize that upon reaching the ischemic site, characterized by acidosis and elevated proteolytic enzymes, the protective coat is cleaved. This unleashes the peroxidase-like activity, but its role is now strategically repurposed. While uncontrolled •OH production is detrimental, a localized, nanozyme-catalyzed burst of •OH can serve as a trigger for targeted drug release or directly induce apoptosis in inflammatory cells, exacerbating the injury [21,24]. This creates a powerful, self-amplifying therapeutic cycle: the initial catalase-like activity salvages the penumbra and controls global oxidative stress, while the activated peroxidase-like activity works in concert with the released RVL, potentiating its neuroprotective or anti-inflammatory effects, to address focal damage and inflammation.
3.5. Cell viability under hypoxia conditions
The biocompatibility of MnO2@RVL@Lf nanozymes was evaluated using MTT assays on NIH-3T3 cells. Notably, no significant cytotoxicity was observed at concentrations ≤10 μg∙mL-1, with cell viabilities of 79.75% (5 μg∙mL-1) and 68.06% (10 μg∙mL-1) (Figure 4a-d). However, dose-dependent toxicity became apparent at higher concentrations (≥15 μg∙mL-1). These findings align with previous reports by Ayyami, et al. [25] confirming the dual functionality of MnO2@RVL@Lf as both a biocompatible catalytic agent and an effective drug delivery platform within a defined therapeutic window.
Treatment with RVL (1-15 μg∙mL-1) and MnO2-based nanozymes (5-25 μg∙mL-1) significantly improved viability in hypoxia-damaged PC12 cells (Figures 4d, e). The therapeutic effects were concentration-dependent, with ≥5 μg∙mL-1 RVL and lower concentrations of nanozymes (MnO2 at 10 μg∙mL-1: 52.9%; MnO2@RVL@Lf at 5 μg∙mL-1: 55.9%) restoring cell viability above 50%. Based on established optimum dose and safety profiles, subsequent in vivo studies employed 5 μg∙mL-1 RVL and 10 μg∙mL-1 MnO2@RVL@Lf nanozymes, respectively (Figure 4f). While previous reports demonstrate protective effects in oxidative stress models [26,27], this study provides the first evidence of their efficacy in hypoxic neuronal injury, offering new therapeutic potential for ischemic conditions.
3.6. Improvement in behavioral deficits
The behavioral outcomes presented here provide compelling in vivo evidence that our MnO₂@RVL@Lf nanozyme platform confers superior functional recovery after ischemic stroke, outperforming the free drug by strategically targeting the multifaceted pathology of the injury (Figure 5). The data delineate a clear hierarchy of efficacy: the nanozyme treatment>RVL alone>untreated stroke model, across both motor and cognitive domains. This hierarchy is not merely a difference in degree, but a reflection of the fundamental therapeutic advantage offered by a multi-mechanistic, nanoscale approach. Ischemic stroke induced profound deficits, as expected, with animals exhibiting a classic phenotype of akinesia (reduced locomotion), diminished exploratory drive, and severe spatial learning impairment [1,24]. The partial restoration of function by free RVL validates its known neuroprotective properties [28], likely stemming from its anti-apoptotic and anti-excitotoxic effects. However, the limitations of this single-mechanism approach are apparent in the delayed and less complete recovery trajectory (Figure 5). Treatment with MnO2@RVL@Lf nanozymes produced a more rapid restoration of exploratory behavior, evidenced by greater upright postures on day 4 compared to RVL alone (p<0.05). By day 6, both treatment groups achieved equivalent behavioral recovery, indicating complete restoration of exploratory function (Figure 5). Spatial learning deficits were quantified using the Morris water maze paradigm. Control animals located the platform in 60.3±2.1 s, while stroke models exhibited severe impairment (>100 s; p<0.001). Control demonstrated progressive learning improvement, reducing platform latency to 36±3.2 s (day 4) and 25±2.8 s (day 6). In stroke models, RVL treatment significantly improved performance to 87.3±5.1 s and 71.6±4.3 s on days 4 and 6, respectively. Notably, MnO2@RVL@Lf nanozymes therapy showed superior efficacy, further reducing latency to 69±4.7 s (day 4) and 43±3.9 s (day 6) (p<0.01 vs. RVL; Figure 5). The superior performance of the MnO₂@RVL@Lf nanozyme, particularly the accelerated restoration of exploratory behavior and the significantly enhanced spatial learning recovery, points to a synergistic therapeutic effect. We posit that this is not simply additive, but multiplicative, arising from the concurrent operation of three distinct yet interconnected mechanisms:

- Schematic diagram and movement trajectories of experimental rats of the open field test and the swimming test. Effect of MnO2, RVL (Resveratrol), and MnO2@RVL@Lf (Lf: Lactoferrin) nanozymes on the number of squares, exercise duration, and number of uprights of experimental rats in the open field experiment. The landing time of experimental rats in the swimming test.
First, the nanozyme platform ensures enhanced bioavailability and targeted delivery of RVL to the compromised brain tissue. The lactoferrin component facilitates receptor-mediated transcytosis across the blood-brain barrier [29], a structure often dysfunctional yet selectively permeable post-stroke. This targeted delivery likely results in a higher effective concentration of RVL at the ischemic penumbra, the region of salvageable tissue, thereby amplifying its intrinsic neuroprotective efficacy.
Second, the MnO₂ core provides potent, catalytic anti-oxidative support [10,24]. As established in our previous findings, the catalase-like activity of the nanozyme continuously scavenges the deleterious H₂O₂ burst that occurs during reperfusion. By converting this oxidative threat into harmless water and even beneficial oxygen, the nanozyme directly quenches the primary driver of secondary neuronal injury. This creates a more permissive microenvironment for neuronal survival and repair, an effect that free RVL alone cannot achieve. The reduction in oxidative stress directly protects synaptic integrity and mitochondrial function, which are fundamental for the neural plasticity required for cognitive recovery.
Third, this anti-inflammatory activity works in concert with RVL’s neuroprotection [4] to break the cycle of damage. The inflammatory cascade, fueled by oxidative stress, is a major contributor to ongoing neural damage. By mitigating this inflammation, the nanozyme halts the expansion of the injury and preserves the neural circuits essential for complex behaviors like spatial navigation and memory, as evidenced by the striking results in the Morris water maze.
3.7. MDA assay and liver enzymes
The MDA serves as a terminal byproduct of lipid peroxidation, with its concentration directly proportional to oxidative stress intensity [30]. Elevated oxidative stress levels correlate strongly with increased lipid membrane damage and consequent MDA generation. As shown in Table 2, stroke conditions increased MDA levels by 2.49-fold compared to controls (p<0.01). Consistent with previous reports by Xie et al. [31], RVL treatment significantly reduced MDA concentrations from 26.21 nmol∙g-1 to 21.30 nmol∙g-1 (p<0.01). Notably, MnO2@RVL@Lf nanozymes demonstrated enhanced therapeutic efficacy, further lowering MDA levels to 16.56 nmol∙g-1 (p<0.05 vs. RVL alone). This significant reduction in MDA levels demonstrates the antioxidant activity of RVL with MnO2 nanozymes [1]. Furthermore, Table 2 displays the serum liver enzyme profiles in healthy and post-stroke rats, revealing significant differences [24,32]. The results indicate that the synergistic effect of RVL and MnO2 nanozymes normalizes liver enzyme levels to baseline (control) values, demonstrating superior efficacy compared to monotherapies.
| Parameters | Control | Stroke | RVL | MnO2@RVL@Lf |
|---|---|---|---|---|
| MDA (nmol∙g-1) | 10.53±1.46 | 26.21±2.17** | 21.30±1.67** | 16.56±1.64* |
| LDH (IU∙L-1) | 546.40±22.49 | 778.46±26.54** | 694.66±19.79** | 649.70±23.46* |
| ALT (IU∙L-1) | 22.06±1.67 | 28.08±2.81** | 26.16±1.29* | 24.43±1.34ns |
| AST (IU∙L-1) | 33.95±2.29 | 41.01±1.96** | 39.48±2.51** | 37.05±1.66* |
| ALP (IU∙L-1) | 41.95±2.09 | 50.85±2.61** | 48.13±2.45* | 44.86±2.37ns |
MDA: Malondialdehyde, LDH: Lactate dehydrogenase, ALT: Alanine aminotransferase, AST: Aspartate aminotransferase, and ALP: Alkaline phosphatase.
Values are presented as mean ± SEM. Significant difference between control and experimental groups: NS, non-significant, *P < 0.05, **P < 0.01, and ***P < 0.001.
3.8. Inflammatory cytokine
The results demonstrated that the expression levels of pro-inflammatory factors (TNF-α, IL-1β, and MMP-9) were significantly elevated in the stroke group, whereas the levels of the anti-inflammatory factor IL-10 were markedly reduced (Figure 6) [33]. Consistent with the findings of Zou et al. [1] and Ashafaq et al. [6], this study demonstrated that RVL treatment significantly reduced the expression levels of pro-inflammatory factors (TNF-α to 6.33, IL-1β to 5.19, and MMP-9 to 1.81) compared to the stroke group. The MnO2@RVL@Lf nanozymes treatment further reduced expression levels of these pro-inflammatory factors to 2.79 (2.26-fold lower than RVL alone), 3.46 (1.50-fold lower), and 1.19 (1.51-fold lower) for TNF-α, IL-1β, and MMP-9, respectively (Figure 6). These results, consistent with the findings of Zou et al. [1], demonstrate that the synergistic combination of RVL and MnO2 nanozymes exhibits significantly enhanced anti-inflammatory effects in rat models compared to RVL monotherapy. Furthermore, both RVL treatment (0.64 vs. 0.48 in stroke controls) and MnO2@RVL@Lf nanozymes (0.81, representing a 1.27-fold increase over RVL alone) significantly elevated IL-10 levels, suggesting enhanced potential for tissue regeneration.

- The effect of RVL (Resveratrol) and MnO2@RVL@Lf (Lf: Lactoferrin) nanozymes on the expression of TNF-α, IL-2β, MMP-9, and IL-10 in brain tissue. #P < 0.10, *P < 0.05, **P < 0.01, and ***P < 0.001 indicate significant differences.
3.9. Histopathology
A histological analysis of the infarcted area has been presented in Figure 7. Healthy tissue exhibits neurons with large, well-defined cytoplasm and distinct nucleoli. In contrast, the ischemic region demonstrates characteristic pathological changes, including (1) paler eosinophilic staining with tissue disaggregation, (2) marked interstitial edema, (3) significantly reduced cellular density, (4) morphological alterations from round to spindle-shaped cellular profiles, and (5) disrupted cytoplasmic integrity. Histological assessment demonstrated that RVL promoted structural recovery in ischemic brain tissue, evidenced by improved tissue density and increased populations of neurons exhibiting characteristic morphological features - including well-defined cytoplasm and prominent nucleoli [34]. However, MnO2@RVL@Lf nanozymes treatment yielded more comprehensive neurorestoration [1,24], producing:
-
Greater preservation of native neuronal cytoarchitecture
-
Enhanced maintenance of spherical cellular morphology
-
More robust cytoskeletal integrity
-
Superior tissue organization

- Hematoxylin and eosin (H & E) staining images of brain tissue sections from experimental rats on day 7 after surgery. Histological assessment of liver and kidney tissues was conducted via H & E staining to evaluate tissue morphology and potential toxicity.
These findings suggest MnO2@RVL@Lf nanozymes surpass RVL in promoting structural recovery following cerebral ischemia. Moreover, histopathological examination (Figure 7) confirmed the absence of significant toxicity, with both MnO2@RVL@Lf nanozymes and drug treatments showing preserved tissue architecture in liver and kidney specimens comparable to healthy controls [24].
4. Conclusions
In this study, we developed a hypoxia-responsive MnO2@RVL@Lf nanozymes capable of crossing the BBB for targeted resveratrol-lactoferrin (RVL) delivery. The nanozymes exhibited favorable physicochemical properties, including uniform size distribution and optimal zeta potential, ensuring colloidal stability and minimal aggregation. Beyond its drug-loading capacity, the MnO2 nanozymes demonstrated hypoxia-triggered drug release, efficient ROS scavenging, and oxygen generation via its dual peroxidase- and catalase-like activities. These multifunctional properties highlight its potential as a promising therapeutic platform for neurodegenerative and hypoxia-related disorders. The MnO2@RVL@Lf nanozymes effectively protected neurons against oxidative stress and reduced inflammatory markers in the injury site. Furthermore, treatment with the nanozymes significantly enhanced motor function and cognitive recovery in rats, correlating with marked histological improvement in the lesioned tissue. Importantly, the nanozymes exhibited no detectable hepatotoxicity or nephrotoxicity, confirming their biocompatibility and therapeutic safety. Collectively, our findings demonstrate the therapeutic potential of MnO2 nanozymes synergized with RVL for the effective treatment of stroke, offering dual neuroprotection (antioxidant/anti-inflammatory) and functional recovery. However, further studies are warranted to:
-
Elucidate the precise molecular mechanisms underlying MnO2@RVL@Lf nanozyme’s action in ischemic stroke,
-
Validate long-term efficacy and safety through large-scale preclinical trials, and
-
Optimize dosing regimens for clinical translation.
Acknowledgment
Zhejiang Provincial Department of Health Project (2024KY389), Science and Technology Plan Projects of Cixi City (CN2023006), Basic Scientific Research Fund Project of Huaian Second People Hospital (HAEY202403).
CRediT authorship contribution statement
C.T., J.X., Z.Y., and T.S.: Conceptualization, Methodology, Investigation, Analysis, Writing. Q.Z., P.L., and H.N.: Supervision, Funding, Writing.
Declaration of competing interest
There are no conflicts of interest.
Declaration of generative AI and AI-assisted technologies in the writing process
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.
References
- Novel lactoferrin-functionalized manganese-doped silica hollow mesoporous nanoparticles loaded with resveratrol for the treatment of ischemic stroke. Materials Today Advances. 2022;15:100262. https://doi.org/10.1016/j.mtadv.2022.100262
- [Google Scholar]
- Immune interventions in stroke. Nature reviews. Neurology. 2015;11:524-535. https://doi.org/10.1038/nrneurol.2015.144
- [Google Scholar]
- Macrophage‐disguised manganese dioxide nanoparticles for neuroprotection by reducing oxidative stress and modulating inflammatory microenvironment in acute ischemic stroke. Advanced Science. 2021;8:1-14. https://doi.org/10.1002/advs.202101526
- [Google Scholar]
- Resveratrol has an overall neuroprotective role in ischemic stroke: A meta-analysis in rodents. Frontiers in Pharmacology. 2021;12:795409. https://doi.org/10.3389/fphar.2021.795409
- [Google Scholar]
- Polyphenols and their impact on the prevention of neurodegenerative diseases and development. Nutrients. 2023;15:3454. https://doi.org/10.3390/nu15153454
- [Google Scholar]
- Nanoparticles of resveratrol attenuates oxidative stress and inflammation after ischemic stroke in rats. International Immunopharmacology. 2021;94:107494. https://doi.org/10.1016/j.intimp.2021.107494
- [Google Scholar]
- Catalytic imaging-guided cancer therapy using non-coordinated and coordinated nanozymes. Coordination Chemistry Reviews. 2024;507:215755. https://doi.org/10.1016/j.ccr.2024.215755
- [Google Scholar]
- Nanozymes: Potential therapies for reactive oxygen species overproduction and inflammation in ischemic stroke and traumatic brain injury. ACS Nano. 2024;18:16450-16467. https://doi.org/10.1021/acsnano.4c03425
- [Google Scholar]
- Synergistic anti-inflammatory effect of cascade nanozymes for neural recovery in ischemic stroke. Chinese Chemical Letters. 2026;37:110956. https://doi.org/10.1016/j.cclet.2025.110956
- [Google Scholar]
- Emerging nanozymes in neurological disorder therapeutics: bridging oxidoreductase mimicry and antioxidant chemistry. Advanced Functional Materials. 2024;34:2405190. https://doi.org/10.1002/adfm.202405190
- [Google Scholar]
- Current strategies for brain drug delivery. Theranostics. 2018;8:1481-1493. https://doi.org/10.7150/thno.21254
- [Google Scholar]
- Transferrin-enabled blood–brain barrier crossing manganese-based nanozyme for rebalancing the reactive oxygen species level in ischemic stroke. Pharmaceutics. 2022;14:1122. https://doi.org/10.3390/pharmaceutics14061122
- [Google Scholar]
- Green synthesis of MnO2 nanoparticles using cumin extract composited with hypericum plant: Investigation of antibacterial and anticancer properties. Journal of Nanostructures. 2023;13:151-158. https://doi.org/10.22052/JNS.2023.01.017
- [Google Scholar]
- Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke. 1989;20:84-91. https://doi.org/10.1161/01.str.20.1.84
- [Google Scholar]
- Green synthesis of manganese dioxide (MnO2) nanoparticles produced with acerola (Malpighia emarginata) leaf extract. Materials Chemistry and Physics. 2024;315:128963. https://doi.org/10.1016/j.matchemphys.2024.128963
- [Google Scholar]
- Design of manganese-based nanomaterials for pharmaceutical and biomedical applications. Journal of Materials Chemistry. B. 2024;12:577-608. https://doi.org/10.1039/d3tb00779k
- [Google Scholar]
- Self-oxygenation mesoporous MnO2 nanoparticles with ultra-high drug loading capacity for targeted arteriosclerosis therapy. Journal of Nanobiotechnology. 2022;20:88. https://doi.org/10.1186/s12951-022-01296-x
- [Google Scholar]
- Modulating the delivery of 5-fluorouracil to human colon cancer cells using multifunctional arginine-coated manganese oxide nanocuboids with MRI properties. ACS Applied Bio Materials. 2020;3:6852-6864. https://doi.org/10.1021/acsabm.0c00780
- [Google Scholar]
- Microwave assisted rapid synthesis and biological evaluation of stable copper nanoparticles using T. arjuna bark extract. Spectrochimica Acta. Part A, Molecular and Biomolecular Spectroscopy. 2013;110:108-115. https://doi.org/10.1016/j.saa.2013.03.005
- [Google Scholar]
- Biosynthesis of silver nanoparticles using Murraya koenigii (curry leaf): An investigation on the effect of broth concentration in reduction mechanism and particle size. Advanced Materials Letters. 2011;2:429-434. https://doi.org/10.5185/amlett.2011.4256
- [Google Scholar]
- Manganese dioxide‐based nanocarrier delivers paclitaxel to enhance chemotherapy against orthotopic glioma through hypoxia relief. Small Methods. 2022;6:2101531. https://doi.org/10.1002/smtd.202101531
- [Google Scholar]
- Developing targeted antioxidant nanomedicines for ischemic penumbra: Novel strategies in treating brain ischemia-reperfusion injury. Redox Biology. 2024;73:103185. https://doi.org/10.1016/j.redox.2024.103185
- [Google Scholar]
- Triple-enzyme mimetic activity of Fe3O4@C@MnO2 composites derived from metal–organic frameworks and their application to colorimetric biosensing of dopamine. Microchimica Acta. 2022;189:12. https://doi.org/10.1007/s00604-021-05114-3
- [Google Scholar]
- The colossal role of H-MnO2-PEG in ischemic stroke. Nanomedicine : Nanotechnology, Biology, and Medicine. 2021;33:102362. https://doi.org/10.1016/j.nano.2021.102362
- [Google Scholar]
- Chitosan-modified manganese oxide-conjugated methotrexate nanoparticles delivering 5-aminolevulinic acid as a dual-modal T1–T2* MRI contrast agent in U87MG cell detection. Magnetic Resonance Materials in Physics, Biology and Medicine. 2024;37:909-924. https://doi.org/10.1007/s10334-024-01169-4
- [Google Scholar]
- Macrophage membrane-coated MnO2 nanoparticles provide neuroprotection by reducing oxidative stress after spinal cord injury. ACS Applied Nano Materials. 2023;6:19073-19087. https://doi.org/10.1021/acsanm.3c03554
- [Google Scholar]
- Manganese dioxide nanoparticles provoke inflammatory damage in BV2 microglial cells via increasing reactive oxygen species to activate the p38 MAPK pathway. Toxicology and Industrial Health. 2024;40:244-253. https://doi.org/10.1177/07482337241242508
- [Google Scholar]
- Chronic resveratrol administration reduces oxidative stress and brain cell loss and improves memory of recognition in old rats. Synapse (New York, N.Y.). 2023;77:e22271. https://doi.org/10.1002/syn.22271
- [Google Scholar]
- Nanocarriers for transportation across the blood-brain barrier. In: Arterial Treatment of Neurological Diseases. Cham: Springer Nature Switzerland; 2025. p. :45-58.
- [Google Scholar]
- Application of nanozymes and its progress in the treatment of ischemic stroke. Translational Stroke Research. 2024;15:880-892. https://doi.org/10.1007/s12975-023-01182-0
- [Google Scholar]
- Resveratrol reduces brain injury after subarachnoid hemorrhage by inhibiting oxidative stress and endoplasmic reticulum stress. Neural Regeneration Research. 2019;14:1734-1742. https://doi.org/10.4103/1673-5374.257529
- [Google Scholar]
- Neuroprotective and anti-inflammatory effect of pterostilbene against cerebral ischemia/reperfusion injury via suppression of COX-2. Frontiers in Pharmacology. 2021;12:770329. https://doi.org/10.3389/fphar.2021.770329
- [Google Scholar]
- Neuroprotective effects of sonochemical- synthesized SiO2 nanoparticles in vivo models of ischemic/reperfusion injury in stroke. Arabian Journal of Chemistry. 2021;14:103416. https://doi.org/10.1016/j.arabjc.2021.103416
- [Google Scholar]
- Reperfusion combined with intraarterial administration of resveratrol-loaded nanoparticles improved cerebral ischemia–reperfusion injury in rats. Nanomedicine: Nanotechnology, Biology and Medicine. 2020;28:102208. https://doi.org/10.1016/j.nano.2020.102208
- [Google Scholar]
