Genetic characterization of Escherichia coli RecN protein as a member of SMC family of proteins

2.1 Media

The Luria–Bertani (LB) and 56/2 buffer salts minimal media were made as described by Lloyd et al. (1974). For minimal agar plates 56/2, buffer salts were diluted with equal volume of 3% (w/v) agar solution. The minimal 56/2 agar plates were supplemented with 1 mg of thiamine, 3.3 g glucose and 0.1 g of the required L-amino acids. MacConkey glactose medium was made by dissolving 40 g MacConkey base (Difico) in 900 ml ddH₂O, sterilized by autoclaving. The volume was completed to one litre with sterilized 10% (w/v) glactose. Induced excision of Tn10 work was preformed as described by Chan et al. (1994).

2.2 Plasmids construction

All recombinant DNA procedures were performed as described by Sambrook et al. (1989). Plasmid pSP100 (Picksley et al., 1985) carries recN gene on 5.6 kb DNA Hind III fragment. pSM106 plasmid (Picksley et al., 1985) was constructed by subcloning 4.9 kb Hind III-Bgl II DNA fragment from pSP100 to pBR322 Hind III-BamH I. pMMY106 is similar to pSM106 but carries recN_K35D mutation. pMMY109 and pMMY110 were constructed from pSM106, pMMY106, respectively, by inserting 1.3 kb blunt end Hae II DNA fragment containing the chloramphenicol gene from pHSG415 downstream the recN gene in PspOMI blunt end site. pMMY107 was constructed by subcloning 5.6 kb Hind III DNA fragment from pSP100 to pBR322 Hind III site. pMMY108 was constructed by deleting 1.728 kb BsrG I-PspOM I DNA fragment containing the entire recN gene from pMMY107 and inserting 1.3 kb blunt end Hae II DNA fragment containing the Cm^r gene from pHSG415 instead of the recN gene.

2.3 Transformation with a linear DNA fragment

Plasmids pMMY108, pMMY109, and pMMY110 contain a unique restriction site for Ata II in the vector (pBR322) sequence. So, pMMY108, pMMY109, and pMMY110 were linearized by digestion with Ata II. Bacterial strain N2525 (recD1009) was made competent by treatment with cold 0.1 M CaCl₂ as described by Sambrook et al. (1989) and exposed to the transforming linear DNA in the same manner as if introducing a circular plasmid DNA. The chloramphenicol resistant transformants were selected and screened for Ampicillin resistance. Ampicillin resistance transformants were discarded while ampicillin sensitive transformants were screened for the mitomycin C sensitivity for ΔrecN108 and recN_K35D. P1 transudation was preformed as described by Miller (1972).

2.4 Unique site elimination (USE) mutagenesis

The procedure of USE mutagenesis was carried out according to the manufacturer (Amersham Pharmacia Biotech) instructions. The target mutagenic primer 5′GCGCGGGTGACTCT ATTGCAAT3′ was used to change the AAA codon of lysine 35 of recN gene in pSM106 DNA to GAC codon of aspartic acid. While, selection mutagenic primer 5′AAACATGAGAAGTCTGAA GAC3′ was used to eliminate the unimportant unique restriction site of EcoR I in pSM106, by changing EcoR I recognition site from 5′GAATTC3′ to 5′GAAATC3′. After completing the USE mutagenesis procedure, plasmid DNA was treated with EcoR I to identify the presumably mutated plasmids. Five plasmids of those which resist digestion with EcoR I were sequenced (MWG Biotech, Germany) using the following primer 5′GTTGCGACAGCCAGATAGCAC TGCCG3′.

2.5 Sensitivity to mitomycin C

Strains were grown in LB broth to mid-log phase (O.D₅₉₅ ∼0.4), washed twice with 56/2 minimal salt buffer and resuspended in the same buffer containing 2 μg/ml mitomycin C. The cells were incubated at 37 °C and samples taken at different times and diluted with 56/2 minimal salt buffer to establish the viable cell count using appropriate serial dilution with 56/2 salt buffer.

2.6 Recombination proficiency

Matings for measuring the recombination proficiency were carried out by growing both the donor and the recipient bacterial strains at 37 °C to OD₅₉₅ ∼0.4. The bacterial strains were mixed in a ratio of 1:10 donor to recipient and incubated at 37 °C in static water bath for 30 min (for F’ donor) or 40 min (for Hfr donor). The mating mixtures were vortexed vigorously and chilled on ice. Samples were diluted in 56/2 minimal salt buffer and plated on 56/2 agar plates lacking proline, supplemented with 100 μg/ml streptomycin. The number of colony forming unites were counted after 2–3 days.

3.1 Mutation of the Walker A nucleotide binding site of recN gene

We are interested in knowing the importance of the Walker A nucleotide binding site to the E. coli RecN protein. The Walker A nucleotide binding site of the E. coli recN gene was mutated (see Section 2). The mutation was transferred to plasmid pSM106 yielding the plasmid DNA containing GAC codon of aspartic acid instead of AAA codon of lysine residue 35 of the recN gene and was designated as pMMY106 (Fig. 1). The mutation was confirmed by partial sequencing (the recN gene in plasmid pMMY106 data not shown) and the mutated recN gene was designated recN_K35D.

Close

Figure 1

Plasmids construction. All the plasmids constructed in this work are pBR322 derivatives. The recN gene in plasmid pSM106 (Picksley et al., 1985) was mutated by site directed mutagenesis to recN_K35D (see below) and the new plasmid designated pMMY106. pMMY109 and pMMY110 plasmids were constructed from pSM106, pMMY106, respectively by inserting 1.3 kb blunt end Hae II DNA fragment containing the chloramphenicol gene from pHSG415 (Hashimoto-Goth et al., 1981) downstream the recN gene in PspOM I blunt end site. pMMY107 plasmid was constructed by subcloning 5.6 kb Hind III DNA fragment containing recN gene from pSP100 (Picksley et al., 1985) into pBR322 Hind III site. pMMY108 was constructed by deleting 1.7 kb BsrG I-PspOM I DNA fragment containing the entire recN gene from pMMY107 and inserting 1.3 kb blunt end Hae II DNA fragment containing the chloramphenicol gene from pHSG415 to 8.2 kb blunt end BsrG I-PspOM I DNA fragment of pMMY107 (instead of the recN gene).

Export to PPT

3.2 Introduction of the recN_K35D gene into E. coli chromosomal DNA

The plasmid pMMY110 carries recN_K35D gene was linearized with Ata II restriction enzyme (Fig. 1), which cut the plasmid only in the vector DNA, and transformed to E. coli N2525 (recD1009) to Cm^R (Table 3). The Ap^R colonies may be produced from undigested plasmid or relegated plasmid inside the bacterial cell while, Ap^S colonies were screened for Mc^S. The loss of Ap^S and presence of Cm^R, Mc^S mean that the linear DNA has integrated into the chromosomal DNA and the Mc^S presumably indicates the integration of recN_K35D into the chromosomal DNA (Fig. 2). The Cm^R, Mc^S, Ap^S strain was designated MMY080. The P1 lysate was made from bacterial strain MMY080 and was used to cross the recN_K35D with Cm^r to bacterial strains AB1157 (wt) and JC7623 (recB21 recC22 sbcB15 sbcC201). Similarly, pMMY109 was used as a control containing recN⁺ gene and Cm^R.

Close

Figure 2

Introduction of the recN_K35D gene into E. coli chromosomal DNA by reverse genetics. The plasmid pMMY110 (containing recN_K35D) was linearized by Aat II restriction enzyme and transformed into E. coli strain N2525 (recD1009). Selection was for Cm^R clones and screened for Ap^S and Mc^S. Clones with Cm^R, Ap^S and Mc^S were presumed to have integrated the DNA fragment containing recN_K35D gene and Cm resistant gene into the chromosomal DNA by homologous recombination.

Export to PPT

3.3 Deletion of the entire recN gene from E. coli chromosomal DNA

The plasmid pMMY108 carries 1.3 kb Cm^R gene instead of recN gene and the entire recN gene was deleted (designated as recN108). The linear pMMY108 DNA was transformed to E. coli N2525 (recD1009) similar to pMMY110. The produced Cm^R, Mc^S, Ap^S bacterial strain (recD1009 recN108) was designated MMY074 (Fig. 3). The P1 lysate was made from bacterial strain MMY074 (recD1009 recN108). The P1 lysate of MMY074 was used to cross the recN108 with Cm^R to bacterial strains AB1157 (wt) and JC7623 (recB21 recC22 sbcB15 sbcC201).

Close

Figure 3

Deletion of the entire recN gene from E. coli chromosomal DNA. A linear DNA fragment from pMMY108 DNA containing Cm resistant gene and deleted the entire recN gene was transformed into E. coli strain N2525 (recD1009). Selection was for CmR clones and screened for ApS, TcS and McS. Clones with CmR, ApS, TcS, and McS were presumed to have integrated the DNA fragment containing Cm resistant gene and deleted recN gene into the chromosomal DNA by homologous recombination.

Export to PPT

3.4 Complementation analysis of recN108, and recN_K35D mutant strains

Having generated bacterial strains to delete the entire recN gene (recN108) and carrying recN gene mutated in the Walker A nucleotide binding site (recN_K35D), we are interested in the examination of mitomycin C sensitivity to these generated bacterial strains. Mitomycin C is a cross linking-agent which causes breaks in both DNA strands and it has been established that recN mutant strains are sensitive to mitomycin C (Picksley et al. 1984a). The results of mitomycin sensitivity to strains MMY100 (recN_K35D), MMY104 (recN108) are illustrated in (Fig. 4). The strains having recN108, recN_K35D, recN261, recN262 are more sensitive to mitomycin C than strain AB1157 (recN⁺) and less sensitive than strain AB2463 (recA13). recN_K35D cells exhibit sensitivity to mitomycin C as recN261, recN262 cells, however recN108 cells show recNmore sensitivity to mitomycin C than recN_K35D, recN261, and recN262 cells.

Close

Figure 4

Mitomycin C sensitivity of E. coli strains SP254 (recN262), SR1087 (recN2001), MMY100 recN_K35D) & MMY104 (recN108). Bacterial strains AB1157 (recN⁺), SP254 (recN262), SR1087 (recN2001), MMY100 recN_K35D), MMY104 (recN108) & AB2463 (recA13) were exposed to mitomycin C 2 μg/ml for defined periods of time (min).

Export to PPT

Bacterial cells recN108, recN_K35D, recN261, recN262 were transfected with plasmid pSP100 (recN⁺) and the mitomycin C sensitivity was examined (Fig. 5). It is clear that plasmid pSP100 restored the mitomycin resistance to recN108, recN_K35D, recN261, recN262 cells comparable to AB1157 (recN⁺), but not to the AB2463 (recA13).

Close

Figure 5

Complementation of the mitomycin C sensitivity of bacterial strains SP254 (recN262), SR1087 (recN2001), MMY100 recN_K35D) & MMY104 (recN108) by the recN⁺ plasmid pSP100. Bacterial strains AB1157 (recN⁺), SP254 (recN262), SR1087 (recN2001), MMY100 recN_K35D), MMY104 (recN108) & AB2463 (recA13) were transfected by the recN⁺ plasmid pSP100 and exposed to mitomycin C 2 μg/ml for defined periods of time (min).

Export to PPT

3.5 Effect of recN_K35D mutation and ΔrecN108 on genetic recombination in rec⁺ and recBC sbcBC cells

The recN_K35D mutation and ΔrecN108 were introduced into AB1157 (rec⁺) and JC7623 (recBC sbcBC) genetic background and the constructed strains were tested for homologous recombination using Hfr donor cells. The data (Table 3) indicate that recN_K35D mutation and ΔrecN108 reduce the homologous recombination in recBC sbcBC cells. A strain carrying ΔrecN108 reduces the recombination proficiency more than a strain carrying recN_K35D mutation. The effect of recN_K35D mutation on the homologous recombination is similar to that of recN262 and recN261 mutations. Also, we observed that both recN_K35D mutation and ΔrecN108 are not important as recN262 and recN261 mutations for homologous recombination in wild type (rec⁺) strains (Picksley et al. 1984a).

3.6 Effect of recN on the excision of Tn10

Chan et al. (1994) have observed that recN gene product is involved in the induced excision of Tn10. From this point of view, we are interested in the examination of the effect of the strains carrying recN_K35D mutation and ΔrecN108 on the induced excision of Tn10 from gal76::Tn10 in AB1157 (rec⁺) and JC7623 (recBC sbcBC) backgrounds. Mitomycin C induces the precise excision of Tn10 from gal76::Tn10 in an E. coli recN⁺ strains. In both AB1157 (rec⁺) and JC7623 (recBC sbcBC) backgrounds the recN_K35D mutation affects in the induced excision of Tn10 from gal76::Tn10 (Table 4). Our studies show that mitomycin C induces the excision of Tn10 in recN_K35D mutant cells. All the tested revertants were found to be Tc^s and Cm^r. The role of ΔrecN108 in excision of Tn10 in AB1157 (rec⁺) background is uninducible by mitomycin C. On the other hand, the ΔrecN108 in JC7623 (recBC sbcBC) background completely blocks the excision of Tn10.