5.2
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
5.3
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
View/Download PDF

Translate this page into:

Original article
7 (
3
); 327-334
doi:
10.1016/j.arabjc.2011.02.001

Genetic characterization of Escherichia coli RecN protein as a member of SMC family of proteins

Mansoura University, Faculty of Science, Chemistry Department, Biochemistry Division, Mansoura, Egypt
Chemistry Department, College of Science, King Faisal University, Saudi Arabia
Department of Biomedical Science, University of Bradford, Bradford BD7 1DP, UK

*Corresponding author at: Mansoura University, Faculty of Science, Chemistry Department, Biochemistry Division, Mansoura, Egypt. Tel.: +966 0534319273 mmm_youssef@yahoo.com (M.M. Youssef)

Disclaimer:
This article was originally published by Elsevier and was migrated to Scientific Scholar after the change of Publisher.

Available online 6 Februray 2011

Peer review under responsibility of King Saud University.

Abstract

The proteins of SMC family are characterized by having Walker A and B sites. The Escherichia coli RecN protein is a prokaryotic member of SMC family that involved in the induced excision of Tn10 and the repair of the DNA double strand breaks. In this work, the Walker A nucleotide binding site of the E. coli RecN protein was mutated by changing the highly conserved lysine residue 35 to the aspartic acid (D), designated as recNK35D. Reverse genetics was utilized to delete the entire recN gene (ΔrecN108) or introduce the recNK35D gene into the E. coli chromosomal DNA. The recNK35D cells showed decrease in the frequency of excision of Tn10 from gal76::Tn10 after treatment with mitomycin C compared to recN+ cells. The ΔrecN108 cells showed an un-induced increase in the frequency of Tn10 excision from gal76::Tn10 in rec+ background while, recBC sbcBC ΔrecN108 cells are completely deficient in Tn10 excision. The recombination proficiency is reduced in cells carrying recBC sbcBC cells in addition recNK35D mutation. We observed that the Walker A nucleotide binding site is important for the RecN protein. Strains that deleted recN gene are recombination deficient and more sensitive to mitomycin C than strains carrying recNK35D.

Keywords

RecN
SMC
Tn10 excision
Recombination
Reverse genetic
1

1 Introduction

The Escherichia coli recN gene was originally identified in recBC sbcB mutant by Lloyd et al. (1983). The recN gene of E. coli was cloned (Picksley et al., 1985) and sequenced (Rostas et al., 1987) and the gene product has a molecular weight of 63 kDa (Finch et al., 1985; Picksley et al., 1985; Rostas et al., 1987; Elie et al., 1997). The RecN protein has the predicted characterization for the proteins belonging to the SMC family of proteins (Hirano et al., 1995). This family of proteins plays an important role in chromosomal condensation and segregation, dosage compensation (Hirano et al., 1995, 1997) and DNA recombinational repair (Connelly et al., 1999; Cao et al., 1990). Members of the SMC family are characterized by having Walker A and Walker B nucleotide binding sites (Walker et al., 1982). The RecN protein belong to subclass of the SMC proteins implicated in DNA repair and recombination that show high sequence similarity in and around the Walker A and Walker B nucleotide binding sites (Hirano et al., 1995; Graumann and Knust, 2009). The recN gene product plays an important role in the RecF recombination pathway in recBC sbcBC (Lloyd et al., 1983; Picksley et al., 1984b). Picksley et al. (1984a) showed that the recN gene product has been involved in the repair of double strand breaks of DNA and that recN mutants strains are sensitive to ionization radiation and mitomycin C. The product of recN gene is involved in the induced excision of Tn10 (Chan et al., 1994; Zhuravel and Boreiko, 2002).

Recombination is an important process that generates genetic variation and preserves the integrity of genome. In E. coli K12 the homologous recombination relies on the product of several genes such as recA (Clark and Margulies, 1965; Cassuto et al., 1980) recB (Howard-Flanders and Theriot, 1966) and recC (Emmersom and Howard-Flanders, 1967). Mutations in the recA gene cause a major deficiency in the recombination which demonstrate that RecA protein is essential for homologous recombination (Emmerson, 1968). The role of the recBCD genes in the recombination is illustrated by the fact that mutation in recBC genes was shown to reduce the homologous recombination proficiency of cells to 1% compared to the wild type (Willetts and Mount, 1969). The RecBCD enzyme is an important component of the main pathway of homologous recombination. The RecBCD enzyme consists of three subunits RecB, RecC and RecD proteins encoded by recB, recC and recD genes, respectively (Hickson and Emmerson, 1981). The RecBCD enzyme is an ATP dependent dsDNA 3′–5′ and 5′–3′ exonuclease (Exonuclease V). Moreover, it has also been shown to have ATP dependent ssDNA endonuclease and exonuclease activity and DNA helicase properties (Goldmark and Linn, 1972). The recombination deficiency in recBC mutants is suppressed by additional mutation in sbcBC genes. The sbcB gene codes for DNA exonuclease I, an enzyme which degrade ssDNA from the 3′ end (Kushner et al., 1972; Lloyd and Buckman, 1985). In recBC sbcBC cells the recombination process is catalyzed by the RecF pathway. The RecF pathway requires a group of genes named recA, recF, recO, recR, recQ, recJ, recN and ruvABC (Clark and Margulies, 1965; Lloyd et al., 1983; Lovett and Clark, 1984; Sawitzke and Stahl, 1992). Bacterial strains carrying recBC sbcBC in addition to recN are recombination deficient (Wang and Maier, 2008). Moreover, recN recJ mutant reduce the recombination in recBC sbcBC cells (Picksley et al., 1984a; Clark et al., 1984; Nagashima et al., 2006). recN gene is expressed and regulated by LexA repressor as a part of the SOS response for recovering the damaged DNA (Picksley et al., 1984b). In recBC sbcBC a single additional mutation in recF, recO, recR, recQ, recJ, recN and ruvABC genes decrease the recombination proficiency (Lovett and Clark, 1984; Kosa et al., 2004).

In the present work we generated two bacterial strains by reverse genetics, one is carrying a recN gene mutated in the Walker A nucleotide binding site while the other the entire recN gene is deleted. We characterized the recN gene by utilizing these two generated bacterial strains in the precise excision of Tn10 and the recombination process.

2

2 Materials and methods

The E. coli K12 strains and plasmids DNA used in this work are listed in Tables 1 and 2.

Table 1 The strains described in the present study.
Strains Genotype (or relevant phenotype) Reference or source
AB1157 F thi-1 thr-1 araC14 leuB6Δ(gpt-proA2)62 Bachmann (1972)
lacY1 tsx-33galK2 λ Rac his G4 rfbD1 rpsl31
strR kdgK51 xylA5 mlt-1 argE3
AB2463 As AB1157 but recA13 Bachmann (1972)
JC7623 As AB1157 but recB21 recC22 sbcB15 sbcC201 Kushner et al. (1971)
MMY096 As AB1157 but CmR to McR CmR P1.MMY080 X AB1157
MMY097 As JC6723 but CmR to McR CmR P1.MMY080 X JC7623
MMY100 As AB1157 but recNK35D to McSCmR P1.MMY094 X AB1157
MMY103 As JC7623 but recNK35D to McS CmR P1.MMY094 X JC7623
MMY104 As AB1157 but ΔrecN108 to McS CmR P1.MMY074 X AB1157
MMY108 As JC7623 but ΔrecN108 to McS CmR P1.MMY074 X JC7623
MMY114 As AB1157 but recNK35D gal-76::Tn10 to TcR McS CmR P1.MMY094 X NF471
MMY116 As AB1157 but ΔrecN108 gal-76::Tn10 to TcRMcS CmR P1.MMY074 X NF471
MMY118 As AB1157 but gal-76::Tn10 to TcRMcR CmR P1.MMY080 X NF471
MMY123 As JC7623 but ΔrecN108, gal76::Tn10 to TcRMcS CmR P1.NF471 X MMY108
MMY124 As JC7623 but recNK35D, gal76::Tn10 to TcR McS CmR P1.NF471 X MMY103
MMY126 As JC7623 but gal76::Tn10 to TcR McR CmR P1.NF471 X MMY097
MMY130 As JC7623 but gal76::Tn10 to TcRMcR P1.NF471 X JC7623
N2525 As AB1157 but recD1009 Lloyd and Buckman (1985)
NF471 As AB1157 but gal-76::Tn10 Chan et al. (1994)
NF618 As AB1157 but recN618 gal-76::Tn10 Chan et al. (1994)
SP226 As JC7623 but recN261 Picksley et al. (1984b)
SP231 As JC7623 but recN262 Picksley et al. (1984b)
SP253 As AB1157 but recN261 Picksley et al. (1984b)
SP254 As AB1157 but recN262 Picksley et al. (1984b)
SP261 As AB1157 but tyrA16::Tn10 Lloyd et al. (1974)
KL226 Hfr (CavaIIi) relA1tonA221 Lloyd and Buckman (1985)
KL584 F128 proAB+ lacI13 lacZ813 Lloyd and Buckman (1985)
Δ(gpt-lac)5 rpsE xyl mtl recA1
Table 2 Plasmids DNA used in the present study.
Plasmid Characterization Reference or source
pBR322 pBR322 high copy plasmid ApR, TcR Bolivar et al. (1977)
pHSG415 pHSG415 low copy plasmid ApR, CmR & KmR Hashimoto-Goth et al. (1981)
pMMY106 As pSM106 but containing recNK35D gene ApR, TcS This work
pMMY107 pBR322 Hind III-5.6 kb Hind III This work
DNA fragment of pSP100 containing recN gene ApR, TcS
pMMY108 pBR322 Hind III-5.6 kb Hind III DNA fragment of pSP100 but ΔrecN gene (1.728 kb BsrG I-PspOM I) and Insertion of 1.33 kb Hae II blunt end DNA fragment of Cm gene from This work
pHSG415 Apr, CmR, TcR, KmS
pMMY109 pSM106 digested with PspOM I and inserted 1.3 kb blunt end Cm PspOM I site down stream of the recN gene pMMY110 pMMY106 (recNK35D) digested with PspOM I This work and inserted 1.3 kb blunt end Cm gene in PspOM I site down stream of the recNK35D gene This work
pMMY112 As pSP100 but contain recNK35D ApR, CmR & KmS This work
pSM106 pBR322 Hind III/ BamH I – 4.9 kb Hind III- Bgl II DNA fragment of pSP100 containing recN gene ApR, TcS Picksley et al. (1985)
pSP100 pSP100 low copy plasmid recN+ ApR, CmR & KmS Picksley et al. (1985)

2.1

2.1 Media

The Luria–Bertani (LB) and 56/2 buffer salts minimal media were made as described by Lloyd et al. (1974). For minimal agar plates 56/2, buffer salts were diluted with equal volume of 3% (w/v) agar solution. The minimal 56/2 agar plates were supplemented with 1 mg of thiamine, 3.3 g glucose and 0.1 g of the required L-amino acids. MacConkey glactose medium was made by dissolving 40 g MacConkey base (Difico) in 900 ml ddH2O, sterilized by autoclaving. The volume was completed to one litre with sterilized 10% (w/v) glactose. Induced excision of Tn10 work was preformed as described by Chan et al. (1994).

2.2

2.2 Plasmids construction

All recombinant DNA procedures were performed as described by Sambrook et al. (1989). Plasmid pSP100 (Picksley et al., 1985) carries recN gene on 5.6 kb DNA Hind III fragment. pSM106 plasmid (Picksley et al., 1985) was constructed by subcloning 4.9 kb Hind III-Bgl II DNA fragment from pSP100 to pBR322 Hind III-BamH I. pMMY106 is similar to pSM106 but carries recNK35D mutation. pMMY109 and pMMY110 were constructed from pSM106, pMMY106, respectively, by inserting 1.3 kb blunt end Hae II DNA fragment containing the chloramphenicol gene from pHSG415 downstream the recN gene in PspOMI blunt end site. pMMY107 was constructed by subcloning 5.6 kb Hind III DNA fragment from pSP100 to pBR322 Hind III site. pMMY108 was constructed by deleting 1.728 kb BsrG I-PspOM I DNA fragment containing the entire recN gene from pMMY107 and inserting 1.3 kb blunt end Hae II DNA fragment containing the Cmr gene from pHSG415 instead of the recN gene.

2.3

2.3 Transformation with a linear DNA fragment

Plasmids pMMY108, pMMY109, and pMMY110 contain a unique restriction site for Ata II in the vector (pBR322) sequence. So, pMMY108, pMMY109, and pMMY110 were linearized by digestion with Ata II. Bacterial strain N2525 (recD1009) was made competent by treatment with cold 0.1 M CaCl2 as described by Sambrook et al. (1989) and exposed to the transforming linear DNA in the same manner as if introducing a circular plasmid DNA. The chloramphenicol resistant transformants were selected and screened for Ampicillin resistance. Ampicillin resistance transformants were discarded while ampicillin sensitive transformants were screened for the mitomycin C sensitivity for ΔrecN108 and recNK35D. P1 transudation was preformed as described by Miller (1972).

2.4

2.4 Unique site elimination (USE) mutagenesis

The procedure of USE mutagenesis was carried out according to the manufacturer (Amersham Pharmacia Biotech) instructions. The target mutagenic primer 5′GCGCGGGTGACTCT ATTGCAAT3′ was used to change the AAA codon of lysine 35 of recN gene in pSM106 DNA to GAC codon of aspartic acid. While, selection mutagenic primer 5′AAACATGAGAAGTCTGAA GAC3′ was used to eliminate the unimportant unique restriction site of EcoR I in pSM106, by changing EcoR I recognition site from 5′GAATTC3′ to 5′GAAATC3′. After completing the USE mutagenesis procedure, plasmid DNA was treated with EcoR I to identify the presumably mutated plasmids. Five plasmids of those which resist digestion with EcoR I were sequenced (MWG Biotech, Germany) using the following primer 5′GTTGCGACAGCCAGATAGCAC TGCCG3′.

2.5

2.5 Sensitivity to mitomycin C

Strains were grown in LB broth to mid-log phase (O.D595 ∼0.4), washed twice with 56/2 minimal salt buffer and resuspended in the same buffer containing 2 μg/ml mitomycin C. The cells were incubated at 37 °C and samples taken at different times and diluted with 56/2 minimal salt buffer to establish the viable cell count using appropriate serial dilution with 56/2 salt buffer.

2.6

2.6 Recombination proficiency

Matings for measuring the recombination proficiency were carried out by growing both the donor and the recipient bacterial strains at 37 °C to OD595 ∼0.4. The bacterial strains were mixed in a ratio of 1:10 donor to recipient and incubated at 37 °C in static water bath for 30 min (for F’ donor) or 40 min (for Hfr donor). The mating mixtures were vortexed vigorously and chilled on ice. Samples were diluted in 56/2 minimal salt buffer and plated on 56/2 agar plates lacking proline, supplemented with 100 μg/ml streptomycin. The number of colony forming unites were counted after 2–3 days.

3

3 Results

3.1

3.1 Mutation of the Walker A nucleotide binding site of recN gene

We are interested in knowing the importance of the Walker A nucleotide binding site to the E. coli RecN protein. The Walker A nucleotide binding site of the E. coli recN gene was mutated (see Section 2). The mutation was transferred to plasmid pSM106 yielding the plasmid DNA containing GAC codon of aspartic acid instead of AAA codon of lysine residue 35 of the recN gene and was designated as pMMY106 (Fig. 1). The mutation was confirmed by partial sequencing (the recN gene in plasmid pMMY106 data not shown) and the mutated recN gene was designated recNK35D.

Plasmids construction. All the plasmids constructed in this work are pBR322 derivatives. The recN gene in plasmid pSM106 (Picksley et al., 1985) was mutated by site directed mutagenesis to recNK35D (see below) and the new plasmid designated pMMY106. pMMY109 and pMMY110 plasmids were constructed from pSM106, pMMY106, respectively by inserting 1.3 kb blunt end Hae II DNA fragment containing the chloramphenicol gene from pHSG415 (Hashimoto-Goth et al., 1981) downstream the recN gene in PspOM I blunt end site. pMMY107 plasmid was constructed by subcloning 5.6 kb Hind III DNA fragment containing recN gene from pSP100 (Picksley et al., 1985) into pBR322 Hind III site. pMMY108 was constructed by deleting 1.7 kb BsrG I-PspOM I DNA fragment containing the entire recN gene from pMMY107 and inserting 1.3 kb blunt end Hae II DNA fragment containing the chloramphenicol gene from pHSG415 to 8.2 kb blunt end BsrG I-PspOM I DNA fragment of pMMY107 (instead of the recN gene).
Figure 1 Plasmids construction. All the plasmids constructed in this work are pBR322 derivatives. The recN gene in plasmid pSM106 (Picksley et al., 1985) was mutated by site directed mutagenesis to recNK35D (see below) and the new plasmid designated pMMY106. pMMY109 and pMMY110 plasmids were constructed from pSM106, pMMY106, respectively by inserting 1.3 kb blunt end Hae II DNA fragment containing the chloramphenicol gene from pHSG415 (Hashimoto-Goth et al., 1981) downstream the recN gene in PspOM I blunt end site. pMMY107 plasmid was constructed by subcloning 5.6 kb Hind III DNA fragment containing recN gene from pSP100 (Picksley et al., 1985) into pBR322 Hind III site. pMMY108 was constructed by deleting 1.7 kb BsrG I-PspOM I DNA fragment containing the entire recN gene from pMMY107 and inserting 1.3 kb blunt end Hae II DNA fragment containing the chloramphenicol gene from pHSG415 to 8.2 kb blunt end BsrG I-PspOM I DNA fragment of pMMY107 (instead of the recN gene).

3.2

3.2 Introduction of the recNK35D gene into E. coli chromosomal DNA

The plasmid pMMY110 carries recNK35D gene was linearized with Ata II restriction enzyme (Fig. 1), which cut the plasmid only in the vector DNA, and transformed to E. coli N2525 (recD1009) to CmR (Table 3). The ApR colonies may be produced from undigested plasmid or relegated plasmid inside the bacterial cell while, ApS colonies were screened for McS. The loss of ApS and presence of CmR, McS mean that the linear DNA has integrated into the chromosomal DNA and the McS presumably indicates the integration of recNK35D into the chromosomal DNA (Fig. 2). The CmR, McS, ApS strain was designated MMY080. The P1 lysate was made from bacterial strain MMY080 and was used to cross the recNK35D with Cmr to bacterial strains AB1157 (wt) and JC7623 (recB21 recC22 sbcB15 sbcC201). Similarly, pMMY109 was used as a control containing recN+ gene and CmR.

Table 3 Conjugation recombination proficiency of bacterial strains carrying recNK35D mutation and ΔrecN108.
Bacterial strain Hfr F
AB157 background
AB1157 (rec+) 1 1
AB2463 (recA13) 0.0005 0.43
MMY096 (rec+, CmR) 0.80 1.07
SP253 (recN261) 0.30 0.54
SP254 (recN262) 0.50 0.75
MMY100 (recNK35D) 0.24 0.60
MMY104 (ΔrecN108) 0.26 0.95
JC7623 background
JC7623 (recBC sbcBC) 0.70 0.80
MMY097 (recBC sbcBC, Cmr) 0.40 0.63
SP226 (recN261) 0.054 0.91
SP231 (recN262) 0.014 0.40
MMY103 (recNK35D) 0.018 0.21
MMY108 (ΔrecN108) 0.006 0.68
Introduction of the recNK35D gene into E. coli chromosomal DNA by reverse genetics. The plasmid pMMY110 (containing recNK35D) was linearized by Aat II restriction enzyme and transformed into E. coli strain N2525 (recD1009). Selection was for CmR clones and screened for ApS and McS. Clones with CmR, ApS and McS were presumed to have integrated the DNA fragment containing recNK35D gene and Cm resistant gene into the chromosomal DNA by homologous recombination.
Figure 2 Introduction of the recNK35D gene into E. coli chromosomal DNA by reverse genetics. The plasmid pMMY110 (containing recNK35D) was linearized by Aat II restriction enzyme and transformed into E. coli strain N2525 (recD1009). Selection was for CmR clones and screened for ApS and McS. Clones with CmR, ApS and McS were presumed to have integrated the DNA fragment containing recNK35D gene and Cm resistant gene into the chromosomal DNA by homologous recombination.

3.3

3.3 Deletion of the entire recN gene from E. coli chromosomal DNA

The plasmid pMMY108 carries 1.3 kb CmR gene instead of recN gene and the entire recN gene was deleted (designated as recN108). The linear pMMY108 DNA was transformed to E. coli N2525 (recD1009) similar to pMMY110. The produced CmR, McS, ApS bacterial strain (recD1009 recN108) was designated MMY074 (Fig. 3). The P1 lysate was made from bacterial strain MMY074 (recD1009 recN108). The P1 lysate of MMY074 was used to cross the recN108 with CmR to bacterial strains AB1157 (wt) and JC7623 (recB21 recC22 sbcB15 sbcC201).

Deletion of the entire recN gene from E. coli chromosomal DNA. A linear DNA fragment from pMMY108 DNA containing Cm resistant gene and deleted the entire recN gene was transformed into E. coli strain N2525 (recD1009). Selection was for CmR clones and screened for ApS, TcS and McS. Clones with CmR, ApS, TcS, and McS were presumed to have integrated the DNA fragment containing Cm resistant gene and deleted recN gene into the chromosomal DNA by homologous recombination.
Figure 3 Deletion of the entire recN gene from E. coli chromosomal DNA. A linear DNA fragment from pMMY108 DNA containing Cm resistant gene and deleted the entire recN gene was transformed into E. coli strain N2525 (recD1009). Selection was for CmR clones and screened for ApS, TcS and McS. Clones with CmR, ApS, TcS, and McS were presumed to have integrated the DNA fragment containing Cm resistant gene and deleted recN gene into the chromosomal DNA by homologous recombination.

3.4

3.4 Complementation analysis of recN108, and recNK35D mutant strains

Having generated bacterial strains to delete the entire recN gene (recN108) and carrying recN gene mutated in the Walker A nucleotide binding site (recNK35D), we are interested in the examination of mitomycin C sensitivity to these generated bacterial strains. Mitomycin C is a cross linking-agent which causes breaks in both DNA strands and it has been established that recN mutant strains are sensitive to mitomycin C (Picksley et al. 1984a). The results of mitomycin sensitivity to strains MMY100 (recNK35D), MMY104 (recN108) are illustrated in (Fig. 4). The strains having recN108, recNK35D, recN261, recN262 are more sensitive to mitomycin C than strain AB1157 (recN+) and less sensitive than strain AB2463 (recA13). recNK35D cells exhibit sensitivity to mitomycin C as recN261, recN262 cells, however recN108 cells show recNmore sensitivity to mitomycin C than recNK35D, recN261, and recN262 cells.

Mitomycin C sensitivity of E. coli strains SP254 (recN262), SR1087 (recN2001), MMY100 recNK35D) & MMY104 (recN108). Bacterial strains AB1157 (recN+), SP254 (recN262), SR1087 (recN2001), MMY100 recNK35D), MMY104 (recN108) & AB2463 (recA13) were exposed to mitomycin C 2 μg/ml for defined periods of time (min).
Figure 4 Mitomycin C sensitivity of E. coli strains SP254 (recN262), SR1087 (recN2001), MMY100 recNK35D) & MMY104 (recN108). Bacterial strains AB1157 (recN+), SP254 (recN262), SR1087 (recN2001), MMY100 recNK35D), MMY104 (recN108) & AB2463 (recA13) were exposed to mitomycin C 2 μg/ml for defined periods of time (min).

Bacterial cells recN108, recNK35D, recN261, recN262 were transfected with plasmid pSP100 (recN+) and the mitomycin C sensitivity was examined (Fig. 5). It is clear that plasmid pSP100 restored the mitomycin resistance to recN108, recNK35D, recN261, recN262 cells comparable to AB1157 (recN+), but not to the AB2463 (recA13).

Complementation of the mitomycin C sensitivity of bacterial strains SP254 (recN262), SR1087 (recN2001), MMY100 recNK35D) & MMY104 (recN108) by the recN+ plasmid pSP100. Bacterial strains AB1157 (recN+), SP254 (recN262), SR1087 (recN2001), MMY100 recNK35D), MMY104 (recN108) & AB2463 (recA13) were transfected by the recN+ plasmid pSP100 and exposed to mitomycin C 2 μg/ml for defined periods of time (min).
Figure 5 Complementation of the mitomycin C sensitivity of bacterial strains SP254 (recN262), SR1087 (recN2001), MMY100 recNK35D) & MMY104 (recN108) by the recN+ plasmid pSP100. Bacterial strains AB1157 (recN+), SP254 (recN262), SR1087 (recN2001), MMY100 recNK35D), MMY104 (recN108) & AB2463 (recA13) were transfected by the recN+ plasmid pSP100 and exposed to mitomycin C 2 μg/ml for defined periods of time (min).

3.5

3.5 Effect of recNK35D mutation and ΔrecN108 on genetic recombination in rec+ and recBC sbcBC cells

The recNK35D mutation and ΔrecN108 were introduced into AB1157 (rec+) and JC7623 (recBC sbcBC) genetic background and the constructed strains were tested for homologous recombination using Hfr donor cells. The data (Table 3) indicate that recNK35D mutation and ΔrecN108 reduce the homologous recombination in recBC sbcBC cells. A strain carrying ΔrecN108 reduces the recombination proficiency more than a strain carrying recNK35D mutation. The effect of recNK35D mutation on the homologous recombination is similar to that of recN262 and recN261 mutations. Also, we observed that both recNK35D mutation and ΔrecN108 are not important as recN262 and recN261 mutations for homologous recombination in wild type (rec+) strains (Picksley et al. 1984a).

3.6

3.6 Effect of recN on the excision of Tn10

Chan et al. (1994) have observed that recN gene product is involved in the induced excision of Tn10. From this point of view, we are interested in the examination of the effect of the strains carrying recNK35D mutation and ΔrecN108 on the induced excision of Tn10 from gal76::Tn10 in AB1157 (rec+) and JC7623 (recBC sbcBC) backgrounds. Mitomycin C induces the precise excision of Tn10 from gal76::Tn10 in an E. coli recN+ strains. In both AB1157 (rec+) and JC7623 (recBC sbcBC) backgrounds the recNK35D mutation affects in the induced excision of Tn10 from gal76::Tn10 (Table 4). Our studies show that mitomycin C induces the excision of Tn10 in recNK35D mutant cells. All the tested revertants were found to be Tcs and Cmr. The role of ΔrecN108 in excision of Tn10 in AB1157 (rec+) background is uninducible by mitomycin C. On the other hand, the ΔrecN108 in JC7623 (recBC sbcBC) background completely blocks the excision of Tn10.

Table 4 Effect of recN mutations on the excision of Tn10 from gal76::Tn10.
Bacterial strain Mitomycin C concentration (ng/ml)
0 2.5 5 10
AB1157 background
MMY118 (rec+, Cmr) 23 236 357 509
MMY114 (recNK35D, Cmr) 21 45 87 111
MMY116 (recN108, Cmr) 413 434 423 441
NF471 (rec+) 28 296 468 626
NF618 (recN618) 20 34 21 29
JC7623 background
MMY130 (recBC sbcBC) 12 38 52 68
MMY126 (recBC sbcBC, Cmr) 10 39 61 88
MMY124 (recBC sbcBC recNK35DCmr) 9 25 28 35
MMY123 (recBC sbcBC recN108, Cmr) 0 0 0 0

NB: All bacterial strains used in the excision Tn10 experiment are gal76::Tn10.

4

4 Discussion

The members of the SMC family of proteins (Hirano et al., 1995, 1997) and various recombinational repair proteins as RecA (Knight and McEntee; 1985), RecB, RecD (Korangy and Julin; 1992) and SbcC (Connelly et al., 1999) have the Walker A nucleotide binding site (Gly-X-X-X-Lys-Ser/Thr where X is any amino acid) (Walker et al., 1982). In addition, the comparison of the RecN protein sequence of various organisms (Funayama et al., 1999) reveals that the RecN protein contains the Walker A nucleotide binding site. The basic amino acid lysine residue in the Walker A nucleotide binding site has been shown to be essential for the RecD protein (Korangy and Julin; 1992). To determine the importance of the Walker A nucleotide binding site to the RecN protein, the highly conserved basic amino acid lysine 35 in the Walker A nucleotide binding site of the E. coli RecN protein was mutated to an acidic amino acid aspartic acid (Fig. 1).

Many reports have used bacterial strains carrying recD mutation and transformed it with linear pieces of DNA containing homology to delete or replace chromosomal genes with genes that had been modified (Chauhudry and Smith, 1984; Russel et al., 1989). In this work, the linear pMMY108 (recN108) and pMMY110 (recNK35D) plasmids carrying the chloramphenicol and ampicillin resistant genes were introduced into recD1009 competent cells. The transformants that integrate the linear plasmids DNA into the chromosomal DNA by homologous recombination were identified presumably for loss of the ampicillin resistant gene and accept the chloramphenicol resistant gene. The deletion of recN or reintroduction of recNK35D into the chromosomal DNA identified in clones shows sensitivity to mitomycin C (Figs. 2 and 3).

The product of recN gene is implicated in the repair of DNA double strand breaks (Picksley et al., 1984a; Meddows et al., 2005). Known recN mutations are sensitive to the mitomycin C a cross linking-agent (Picksley et al., 1984a,b; Chan et al., 1994; Funayama et al., 1999). The strains carrying recNK35D and recN108 show sensitivity to mitomycin C (Fig. 4). It is clear that, ΔrecN108 cells are more sensitive to the mitomycin C than recNK35D and the identified recN mutations. The pSP100 (recN+) plasmid DNA restores the resistant to the mitomycin C of strains carrying recNK35D and ΔrecN108 to the level of wild type strains (recN+).

The recombination in rec+ strains is activated by RecBCD pathway and recN gene product not implicated in this pathway. In recBC strains the recombination proficiency is restored by additional mutation in sbcA or sbcBC. In recBC sbcA background the recombination is catalyzed by the RecE pathway and recN gene product is not involved in this pathway (Robbins-Manke et al., 2005). On the other hand, in the recBC sbcBC cells the recombination is catalyzed by the RecF pathway and recN gene product have an important role in the RecF pathway (Picksley et al., 1984a; Wang and Maier, 2008). In this study we observed that recN108 in recBC sbcBC background reduce the homologous recombination more than any of the recN mutation in recBC sbcBC background (Table 3).

Many of the SOS genes were found to be implicated in the precise excision of Tn10 (Chan et al., 1994). recN gene is induced as one of the SOS genes under the regulation of LexA repressor to remind the damaged DNA (Picksley et al., 1984b; Kosa et al., 2004). The data (Table 4) indicate that recN gene product have a role in the excision of Tn10 in rec+ and recBC sbcBC background. The frequency of revertants of gal+ is decreased in recNK35D strains than that of the recN+ in AB1157 and JC7623 background.

Acknowledgments

We thank Dr. R.G. Lloyd (UK) and Dr. R. Nagel (Argentina) for bacterial strains they provided to achieve this work.

References

  1. , . Pedigrees of some mutant strains of Escherichia coli K 12. Bacteriol. Rev.. 1972;36:525-557.
    [Google Scholar]
  2. , , , , , , , , . Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene. 1977;2:95-113.
    [Google Scholar]
  3. , , , . A pathway for the generation and processing of double-strand breaks during meiotic recombination in Saccharomyces cerevisiae. Cell. 1990;61:1089-1101.
    [Google Scholar]
  4. , , , , , . Initiation of genetic recombination: homologous pairing between duplex DNA molecules promoted by RecA protein. Proc. Natl. Acad. Sci. USA. 1980;77:3962-3966.
    [Google Scholar]
  5. , , , . recN SOS gene and induced precise excision of Tn10 in Escherichia coli. Mutat. Res.. 1994;235:75-79.
    [Google Scholar]
  6. , , . A new class of Escherichia coli recBC mutants: implications for the role of RecBC enzyme in homologous recombination. Proc. Natl Acad. Sci. USA. 1984;81:7850-7854.
    [Google Scholar]
  7. , , . Isolation and characterisation of recombination deficient mutants of Escherichia coli K12. Proc. Natl. Acad. Sci. USA. 1965;13:451-459.
    [Google Scholar]
  8. , , , , , , . Genes of the RecE and RecF pathways of conjugational recombination in Escherichia coli. Cold Spring Harb. Symp. Quant. Biol.. 1984;49:453-462.
    [Google Scholar]
  9. , , , . DNA cleavage and degradation by the SbcCD protein complex from Escherichia coli. Nucleic Acids Res.. 1999;27:1039-1046.
    [Google Scholar]
  10. , , , , . A protein related to eucaryal and bacterial DNA-Motor proteins in the hyperthermophilic Archaeon sulfolobus acidocaldarius. J. Mol. Evol.. 1997;45:107-114.
    [Google Scholar]
  11. , , . Cotransduction with thy of a gene required for genetic recombination in Escherichia coli. Bacteriology. 1967;93:1729-1731.
    [Google Scholar]
  12. , . Recombination-deficient mutants of Escherichia coli K12 that map between thyA and argA. Genetics. 1968;60:19-30.
    [Google Scholar]
  13. , , , . Identification of the Escherichia coli recN gene product as a major SOS protein. Bacteriology. 1985;164:653-6658.
    [Google Scholar]
  14. , , , , , , . Identification and disruption analysis of the recN gene in the extremely radioresistant bacterium Deinococcus radiodurans. Mutat. Res.. 1999;435:151-161.
    [Google Scholar]
  15. , , . Purification and properties of the recBC DNase of Escherichia coli K12. J. Biol. Chem.. 1972;247:1849-1860.
    [Google Scholar]
  16. , , . Dynamics of the bacterial SMC complex and SMC-like proteins involved in DNA repair. Chromosome Res.. 2009;17:265-275.
    [Google Scholar]
  17. , , , , . Specific purpose plasmid cloning vectors I. Low copy number, temperature sensitive, mobilization defective pSC101 derived containment vectors. Gene. 1981;16:227-235.
    [Google Scholar]
  18. , , . Identification of Escherichia coli recB and recC gene products. Nature. 1981;294:578-580.
    [Google Scholar]
  19. , , , . The SMC family: from chromosome condensation to dosage compensation. Curr. Opin. Cell Biol.. 1995;7:329-336.
    [Google Scholar]
  20. , , , . Condensins, chromosome condensation protein complexes containing XCAP-C, XCAP-E and a Xenopus homolog of the Drosophila barren protein. Cell. 1997;89:511-521.
    [Google Scholar]
  21. , , . Mutants of Escherichia coli K 12 defective in DNA repair in genetic recombination. Genetics. 1966;53:1137-1150.
    [Google Scholar]
  22. , , . Covalent modification of the RecA protein from E. coli with the photoaffinity label 8 azidoadenosine 5′ triphosphate. J. Biol. Chem.. 1985;260:867-872.
    [Google Scholar]
  23. , , . Enzymatic effect of a lysine to glutamine mutation in the ATP binding consensus in the RecD subunit of the RecBCD enzyme from E. coli. J. Biol. Chem.. 1992;267:1733-1740.
    [Google Scholar]
  24. , , , , , . RecN and RecG are required for Escherichia coli survival of bleomycin-induced damage. Mutat. Res.. 2004;554:149-157.
    [Google Scholar]
  25. , , , , . Genetic recombination in Escherichia coli: the role of exonuclase I. Proc. Natl. Acad. Sci. USA. 1971;68:824-827.
    [Google Scholar]
  26. , , , . Indirect suppression of recB and recC mutations by exonuclease I deficiency. Proc. Natl. Acad. Sci. USA. 1972;69:1366-1370.
    [Google Scholar]
  27. , , . Identification and genetic analysis of sbcC mutations in commonly used recBC sbcB strains of Escherichia coli K12. Bacteriology. 1985;164:836-844.
    [Google Scholar]
  28. , , , . Isolation and characterisation of an Escherichia coli mutant with a temperature sensitivity RecA phenotype. Bacteriology. 1974;120:407-415.
    [Google Scholar]
  29. , , , . Inducible expression of a gene specific to the RecF pathway for recombination in Escherichia coli K12. Mol. Gen. Genet.. 1983;190:162-167.
    [Google Scholar]
  30. , , . Genetic analysis of the recJ gene of Escherichia coli. Bacteriology. 1984;157:190-196.
    [Google Scholar]
  31. , , , , , . RecN protein and transcription factor DksA combine to promote faithful recombinational repair of DNA double-strand. Mol. Microbiol.. 2005;57(1):97-110.
    [Google Scholar]
  32. , . Experiments in molecular genetics. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; .
  33. , , , , , , . Degradation of Escherichia coli RecN aggregates by ClpXP protease and its implications for DNA damage tolerance. Biol. Chem.. 2006;281(41):30941-30946.
    [Google Scholar]
  34. , , , . Repair of DNA double-strand breaks in Escherichia coli K12 requires a functional recN product. Mol. Gen. Genet.. 1984;195:267-274.
    [Google Scholar]
  35. , , , . Genetic analysis and regulation of inducible recombination in Escherichia coli K12. Cold Spring Habor Symp. Quant. Biol.. 1984;49:469-474.
    [Google Scholar]
  36. , , , . The recN locus of Escherichia coli K12: molecular analysis and identification of the gene product. Mol. Gen. Genet.. 1985;201:301-307.
    [Google Scholar]
  37. , , , , . Analysis of global gene expression and double-strand-break formation in DNA adenine methyltransferase- and mismatch repair-deficient Escherichia coli. J. Bacteriol.. 2005;187:7027-7037.
    [Google Scholar]
  38. , , , , . Nucleotide sequence and LexA regulation of the Escherichia coli recN gene. Nucleic Acids Res.. 1987;15:5041-5049.
    [Google Scholar]
  39. , , , . Chromosomal transformation of Escherichia coli recD strains with linearized plasmids. Bacteriology. 1989;171:2609-2613.
    [Google Scholar]
  40. , , , . Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; .
  41. , , . Phage lambda has an analog of Escherichia coli recO, recR, and recF genes. Genetics. 1992;130:7-16.
    [Google Scholar]
  42. , , , , . Distantly related sequences in the α- and β-subunits of ATP synthase, myosin, kinases and other ATP- requiring enzymes and a common nucleotide binding fold. EMBO J.. 1982;1:945-951.
    [Google Scholar]
  43. , , . Critical role of RecN in recombinational DNA repair and survival of Helicobacter pylori. Infect. Immun.. 2008;76(1):153-160.
    [Google Scholar]
  44. , , . Genetic analysis of recombination deficient mutants of Escherichia coli K12 carrying rec mutations with thyA. Bacteriology. 1969;100:923-934.
    [Google Scholar]
  45. , , . Regularities of excising transposon Tn10 in rec-mutant E. coli cells exposed to gamma radiation. Radiats. Biol. Radioecol.. 2002;42(6):636-638.
    [Google Scholar]
Show Sections