Ginkgo biloba-derived biogenic silver nanoparticles suppress the proliferation of C6 glioma cells via apoptosis, cell cycle arrest, and anti-migratory activity

2.1. Sample collection

Dried leaves of the Ginkgo biloba plant were obtained from a commercial supplier. Upon arrival, they were verified and kept dry until use.

2.2. Synthesis of nanoparticles

Approximately 20 g of the dried and coarsely powdered plant sample was immersed in 200 mL of sterile water. It was then boiled for 30 min in a water bath and cooled. The extract solution was passed through the Whatman filter paper, and the resulting filtrate was gathered in a separate container. To 20 mL of this filtrate, 180 mL of a 1 mM AgNO₃ solution was added, stirred with a magnetic stirrer, and left to incubate in darkness overnight at ambient temperature to minimize photoactivation. The transition of the mixture from colorless to brown was observed as an indication of the reduction of Ag⁺ to Ag⁰. The formed brown-colored mixture was centrifuged to collect the pellet, washed twice with sterile water, and dried in an open petri dish. The final dried product was scraped off, yielding 2 mg of synthesized nanoparticles.

2.3. Characterization of nanoparticle

The X-ray diffraction (XRD) analysis of the nanomaterials was carried out using a Rigaku diffractometer with Cu-Kα radiation in the range of 20-80° at a voltage of 40 kV and a current of 40 mA, with a scan rate of 0.020 s⁻¹. The attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectra of AgNPs were recorded using a Perkin Elmer UATR-II model (Beaconsfield, Bucks, United Kingdom) to examine the functional groups in the range of 4000-400 cm⁻¹. The optical properties of the developed nanomaterials, as determined by ultraviolet-visible diffuse reflectance spectroscopy (UV-DRS), were studied using a JASCO V760 spectrophotometer. The morphology of the nanomaterials was analyzed using a FEI Tecnai G2 20 S-TWIN transmission electron microscope (TEM). The chemical composition and oxidation states of the nanomaterials were investigated using a Carl Zeiss X-ray photoelectron spectroscopy (XPS) system under ultra-high vacuum conditions and Al Kα excitation at 250 W.

2.4. Cell culture

L929 (mouse fibroblast) cells and C6 (Rat glioma) cells were procured from ATCC. They were cultured in a CO₂ incubator using Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics. Confluent cells were used for further experiments.

2.5. Cytotoxicity assay

Basic cellular toxicity was first determined using L929 cells. Briefly, 5 × 10³ cells/well were plated into 96-well culture plates and incubated overnight in a CO₂ incubator. After 24 h, the GB-AgNP solution was prepared and sterilized using a 0.22 µm filter, and then added to the 96-well attached monolayer at different concentrations, ranging from 100 µg/mL at the highest concentration to 6.25 µg/mL at the lowest concentration. The plate was then incubated for an additional 24 h. After treatment, the plates were removed from the incubator to examine the cell morphology using an inverted phase-contrast microscope. Morphological changes such as cell rounding, shrinking, blebbing, and vacuole formation in the cytoplasm were observed and photographed.

The MTT assay was performed to measure cellular toxicity and obtain the IC₅₀ value. Briefly, 100 µL of MTT solution (5 mg/mL) was added to each well, followed by simple agitation, and kept in the incubator for another 4 h. After incubation, the plates were taken from the incubator, and the supernatant was carefully removed without disturbing the pellet formed at the bottom of the wells. The formed formazan crystals are then solubilized using 100 µL of DMSO and gentle pipetting without the formation of bubbles. A microplate reader measured the color formed as absorbance at 540 nm. The percentage viability of the cells with treatment and control was calculated using the following (Eq. 1).

2.6. Anti-cancer effect of GB-AgNPs against C6 (Rat glioma) cells in vitro

The assay was conducted as described in the earlier cytotoxicity method with slight modifications. Briefly, confluent C6 cells were transferred into the 96-well plate at a density of 10000 cells/well. After 24 h of incubation, the GB-AgNP was added to the plate at different concentrations in a serial dilution. The plates were incubated for an additional 24 h in a CO₂ incubator. The morphology of the cells was examined and documented as described earlier, and then the MTT assay was performed. The absorbance of the purple color formed was recorded at 540 nm, and the IC₅₀ values were calculated.

2.7. Apoptosis detection by Annexin V assay

C6 rat glioma cells grown in complete DMEM medium were transferred to a T25 tissue culture flask and kept overnight in a CO₂ incubator. The test compound was treated with the cells at a dose of IC₅₀ obtained (17.13 µg/mL), while one untreated flask was kept as a control. All the experiments were done in triplicate. After 24 h, the cells were detached and transferred into Eppendorf tubes, ensuring that at least one million cells were present in each tube for fixation. The cell samples were centrifuged at 3000 rpm for 5 min to obtain pellets, which were then washed with 1X PBS to remove residual medium. The final separated pellets were added with 100 µL of Muse™ Annexin V & Dead Cell Reagent. The sample was mixed gently by pipetting and vortexing for 5 s and then incubated for 20 min at room temperature (RT) in the dark. The stained cells were analyzed for Annexin V fluorescence detection using a flow cytometer equipped with Muse FCS 3.0 software. Meanwhile, untreated control cells were used to gate and create a baseline fluorescence. The software measured and quantified the externalization of phosphatidylserine from the cells to the outer layer.

2.8. Indirect ELISA for detection of Caspase -3,-7, and -9

C6 cells were grown in a T25 culture flask overnight in a CO₂ incubator until confluence. Then, the cells were treated with the test samples at a concentration of 17.13 µg/mL. Another flask was kept as a control flask, untreated. After 24 h of incubation, supernatant from the respective flasks was collected, and 100 µL was transferred into separate 96-well plates and incubated for an additional 24 h at 37°C. The following day, the wells were emptied and washed with PBS. Subsequently, 200 µL of blocking PBS (containing 0.2% gelatin and 0.05% Tween 20) was added to each well and incubated for 1 h at RT to prevent nonspecific antibody binding. One additional plate wash was done with the same blocking PBS, and then 100 µL of primary antibody specific to the target (Caspase -3,-7, and -9) was added, followed by a 2 h incubation at RT. After two PBS washes, 100 µL of HRP-conjugated secondary antibody was added and incubated for 1 h at RT. The unbound secondary antibody was removed by PBS washing. Then, 200 µL of substrate solution was added, and the reaction was incubated for 30 min. The reaction was then stopped with 50 µL of 5N HCl. Absorbance was measured at 415 nm using an ELISA reader.

2.9. Cell migration by in vitro wound healing assay

Exponentially growing C6 cells were plated into a 12-well plate at a density of 2 × 10⁵ cells per well and incubated for 24 h until they reached 90% confluency. Using a 100 µL pipette tip, a straight-line wound was created in the confluent monolayer of the cells. PBS was used to rinse and remove any debris formed. Then the test sample was added at a concentration of 17.13 µg/mL, and plates were incubated for different time points (24, 48, and 72 h). Photographs were captured over the pre-marked areas at all time points, and wound closure was observed. The images were quantified using the ImageJ software.

2.10. Cell cycle analysis

C6 cells were cultured in a T25 flask treated with the IC⁵⁰ dose of the test compound, while a separate flask served as the control. After 24 h, cells were harvested and transferred to an Eppendorf tube, ensuring a minimum of 1 million cells per sample. The cell pellets were washed with PBS by centrifugation at 3000 rpm for 5 min and stored for subsequent experiments. The pellet was then resuspended in PBS, vortexed, and centrifuged again at 3000 rpm for 5 min. The supernatant was carefully removed, leaving approximately 50 µL of PBS with the pellet. The cells were resuspended, fixed by gradually adding 1 mL of ice-cold 70% ethanol during vortexing, and stored at -20°C overnight. The following day, fixed cells were thawed, centrifuged at 3000 rpm for 5 min to discard the supernatant, and washed twice with PBS. The cells were then added with RNase A and PI, and kept in the dark at RT for approximately 30-45 min. The cell population was then analyzed using flow cytometry.

2.11. Real-time PCR

C6 cells were plated into a T25 flask and allowed to grow overnight, then the test flask was treated with the test sample at an IC₅₀ concentration. Both treated and control flasks were allowed to grow for 24 h. Later, 1 mL of Trizol reagent was added to each flask and incubated for 5 min to dissociate the nucleoprotein complex. The mixture was then transferred to an aseptic tube, and 200 µL of chloroform was added and kept at RT. The samples were then centrifuged at 14000 rpm at 4°C for 5 min. The supernatant was carefully collected, and 500 µL of isopropanol was added and incubated at RT for 10 min. The contents were centrifuged for 15 min at 14000 rpm, and the supernatant was discarded. The remaining pellets in the tube were washed with 200 µL of 75% ethanol. One final round of centrifugation was performed on the mixture at 14000 rpm for 15 min at 4°C. The tube was then opened and allowed to dry in air, and subsequently added to the RE buffer. The purity and integrity of the isolated RNA were calculated, and then cDNA synthesis was performed using a conversion kit, following the manufacturer’s protocol.

RT-qPCR was conducted to analyze the expression of the selected gene in treated and control samples. The reaction was performed using SYBR Green Master Mix on a LightCycler 96 system. All reactions were carried out in triplicate, and the final data were analyzed using the ΔΔCt method. The RT-qPCR protocol included an initial activation step at 95°C for 2 min, followed by 40 cycles of three-step cycling: denaturation at 95°C for 10 sec, annealing at 58°C for 1 min, and extension at 72°C for 1 min per kb. The reaction was terminated with an indefinite hold at 4°C. Primer sequences for target genes (p53, p21, and Bax) and the reference gene (Gapdh) were designed with specific melting temperatures (Tm). For p53, forward (GCTCTGACTGTACCACCATCC, Tm: 62°C) and reverse (CTCTCGGAACATCTCGAA\GCG, Tm: 62.7°C); for p21, forward (GAGCAGTGCCCGAGTTAAGG, Tm: 60.1°C) and reverse (TGGAACAGGTCGGACATCAC, Tm: 59.6°C); for Bax, forward (ATGGACGGGTCCGGGGAG, Tm: 65.6°C) and reverse (TGGAAGAAGATGGGCTGA, Tm: 55.5°C); and for Gapdh, forward (AATGCATCCTGCACCACCAACTGC, Tm: 64.4°C) and reverse (GGAGGCCATGTAGGCCATGAGGTC, Tm: 67.8°C). These primers enabled precise quantification of gene expression levels, ensuring robust and reproducible results.

2.12. Statistical analysis

All raw data have been tested for statistical analysis using SPSS software. All experiments were carried out in triplicate (n=3). Students used t-tests and ANOVA to check the significance level, and P values were considered significant if p < 0.05, unless otherwise specified at a different level, as mentioned in the respective methodology sections.

3.1. Synthesis and UV characterization of Ginkgo biloba-AgNPs

The synthesis of nanoparticles represents a promising area in nanotechnology, focusing on creating eco-friendly solutions for biomedical applications, including cancer therapy. Previous research has extensively investigated the eco-friendly synthesis of metallic nanoparticles, including silver nanoparticles, using various plant extracts and their bioactive constituents. Nevertheless, there is still significant potential to investigate nanoparticle synthesis using other potential plant species. In this context, our study focused on synthesizing silver nanoparticles using an aqueous leaf extract of Ginkgo biloba and assessing their effects on glioma cells in vitro. It also explored the mechanisms underlying the inhibition of cell proliferation. In the current study, green synthesis of silver nanoparticles using leaf extract was identified by a color change from a pale brown to a dark brown solution of silver chloride in the dark with constant stirring (Figure 1a). This bio-reduction of the formatting of AgNPs has been further supported by the capping effect of secondary metabolites, such as steroids, terpenoids, sapogenins, carbohydrates, and flavonoids, which act as reducing agents in the formation of nanosilver from silver ions [11]. The absorbance spectra of green-synthesized AgNPs were recorded in the 200-1100 nm range. The maximum absorption spectrum was recorded at 432 nm, corresponding to the reduction of Ag⁺ ions to Ag⁰ (Figure 1b). Prior studies have reported surface plasmon resonance (SPR) peaks typically within 400-500 nm [12]. The strong absorption peak observed at 270 represents the presence of polyphenolic compounds in the extract. These polyphenols have a critical role as natural reducing agents, converting silver ions (Ag⁺) to metallic silver (Ag⁰) by donating electrons during green synthesis [13]. Furthermore, these polyphenols act as stabilizing agents, preventing nanoparticle aggregation and regulating their size and morphology.

Close

Figure 1.

Biosynthesis of GB-AgNPs using aqueous leaf extract of Ginkgo biloba. (a) Various stages of a nanoparticle. (b) UV-Vis spectra of biosynthesis of GB-AgNPs.

Export to PPT

3.2. FESEM and EDAX analysis

Field-emission scanning electron microscopy (FESEM) was used to investigate the precise morphology and dimensions of AgNPs, as shown in Figure 2(a). The FESEM observations revealed that the AgNPs have an agglomerated spherical shape with a size range of 15-35 nm and an average diameter of approximately 25 nm. The chemical composition of the AgNPs was analyzed using energy-dispersive X-ray (EDX) spectroscopy coupled with the FESEM. The EDX results (Figure 2b) revealed the presence of carbon (C) at 85.02% and silver (Ag) at 14.02%, verifying the elemental constitution of the nanoparticles. The elevated carbon levels are likely due to biological macromolecules encasing the AgNPs, possibly derived from the plant extract used in their synthesis [14].

Close

Figure 2.

(a) SEM image, (b) EDX pattern, (c) DLS histogram for particle size distribution, and (d) XRD pattern of GB-AgNPs.

Export to PPT

3.3. XRD analysis

The dried powder of AgNPs, prepared via a green synthesis method, was analyzed using XRD. The XRD profile for these green-synthesized AgNPs has been presented in Figure 2(c). Data collection occurred over a 2θ angular range, revealing diffraction peaks at 37.95°, 44.15°, 64.27°, and 77.18°. These peaks are consistent with the diffraction pattern of AgNPs (JCPDS file no. 00-004-0783) and correspond to the hkl planes (111), (200), (220), and (311), respectively. These findings align with prior research on Ag NPs [15]. The observed peaks indicate a face-centered cubic (fcc) crystalline structure for metallic silver. The mean crystallite size of the AgNPs was determined using the Debye-Scherrer formula (Eq. 2),

where D represents the crystallite size, k is the shape factor (0.9), λ is the X-ray wavelength, β is the full width at half maximum (FWHM), and θ is the Bragg angle. The calculated average crystallite size of the AgNPs was found to be 23 nm.

3.4. Dynamic light scattering (DLS) analysis

DLS analysis was conducted to assess the hydrodynamic size of AgNPs. The results (Figure 2d) indicated a hydrodynamic diameter of 103.30 nm, encompassing both the metallic core and the surrounding solvation layer, which is composed of stabilizing agents and surface-bound biomolecules derived from the green synthesis process. This hydrodynamic size is notably larger than the crystalline size determined by XRD, suggesting the presence of a hydration shell and potential surface functionalization. These factors enhance the colloidal stability of the AgNPs in suspension. It should be noted that DLS measures the effective diameter of nanoparticles in a dispersed state rather than their actual physical size [16]. Therefore, the average size of biosynthesized AgNPs, as determined by DLS, exceeds that measured by SEM. Studies showed that the larger size of AgNPs observed in DLS analysis compared to SEM is attributed to the influence of Brownian motion [17]. In the current research, the polydispersity index of the GB-AgNPs was 0.148. According to earlier studies, a polydispersity index of less than 0.5 is considered a “good” quality [18]. Hence, it can be concluded that the green synthesis carried out in the current research resulted in a nearly monodisperse colloidal dispersion of AgNPs.

3.5. TEM and SAED patterns

Figure 3 illustrates the results of HRTEM, where higher and lower magnifications of AgNPs have been represented in Figures 3(c-d). According to the results, the synthesized AgNPs have a spherical structure with an average particle size ranging from 15 to 35 nm and a uniform grain size. The crystallinity of AgNPs was verified through selected area electron diffraction (SAED) analysis (Figure 3e). The SAED pattern revealed hkl planes (111), (200), (220), and (311), consistent with XRD data, and no impurities were detected.

Close

Figure 3.

TEM image of AgNPs of leaf extracts of Ginkgo biloba. (a-d) HRTEM images at higher and lower magnification. (e) SAED pattern.

Export to PPT

3.6. FTIR analysis

AgNPs are synthesized using green synthesis methods, which utilize phytochemicals and biomolecules to stabilize the particles during the synthesis process. This stabilization is possible due to the various functional groups present in the extract and their interaction with the particle surface. FTIR helps in identifying these functional groups, including their binding modes and molecular interactions. In the current research, FTIR analysis of Ginkgo biloba extract revealed the presence of various functional groups associated with bioactive compounds, as recorded between 4000 and 500 cm^-1 (Figure 4). The analysis of GB extract and GB AgNPS showed the peaks at 3408, 2921, 2851, 1632, 1384, 1113, 1040, 869, 609 cm^-1 and 3408, 2925, 2859, 1632, 1381, 1064, 765, 609 cm^-1, respectively. The O–H stretching vibrations observed at 3408 cm^-1 in the GB extract correspond to the hydroxyl groups responsible for polyphenols and flavonoids. Peaks at 2921 and 2851 cm⁻¹ represent C–H stretching vibrations, characteristic of aliphatic chains in terpenoids. The peak at 1632 cm⁻¹ corresponds to C=C stretching in aromatic rings, suggesting the presence of flavonoid structures. Additional peaks at 1384, 1113, and 1040 cm⁻¹ are attributed to C–H bending and C–O stretching vibrations, confirming the presence of alcohols, ethers, and phenolic compounds. The peaks at 869 and 609 cm⁻¹ indicate aromatic ring deformations. These characteristic peaks confirm the presence of flavonoids, terpenoids, and polyphenols, which contribute to the extract’s reducing, stabilizing, and bioactive properties.

Close

Figure 4.

FTIR spectrum of leaf extract of Gingko Biloba and green-synthesized GB-AgNPs.

Export to PPT

3.7. XPS analysis

The wide-scan XPS spectrum of green-synthesized AgNPs confirmed the presence of Ag 3d states and C 1s components (Figure 5a), indicating their oxidation state and surface chemical composition. Figure 5(b) shows that the C 1s spectrum provides insight into the role of plant extracts in the synthesis process. Peaks at 282.88 eV and 284.63 eV correspond to different oxidation states of carbon, likely originating from biomolecular residues in the plant extract used for synthesis. These carbon species may be associated with functional groups such as C–C, C–O, and C=O, commonly found in polyphenols, flavonoids, proteins, and other phytochemicals responsible for reducing and stabilizing AgNPs during green synthesis. The formation mechanism of AgNPs via green synthesis involves three key stages: reduction, nucleation, and growth, facilitated by biomolecules present in the plant extract [19]. Phytochemicals, such as polyphenols, flavonoids, terpenoids, and proteins, act as reducing agents by donating electrons to Ag⁺ ions, leading to their reduction into neutral Ag⁰ atoms [20]. Once formed, Ag⁰ atoms aggregate into small clusters, initiating nucleation. The stability of these nuclei depends on the concentration of reducing agents and reaction conditions. As the reaction progresses, the Ag nuclei grow by accumulating Ag⁰ atoms, ultimately forming nanoparticles. The XPS Ag 3d spectrum confirms this mechanism (Figure 5c), showing peaks at 365.38 eV, 367.68 eV, 371.75 eV, and 373.74 eV, corresponding to Ag 3d5/2 and Ag 3d3/2 spin-orbit components. These peaks confirm the presence of metallic (Ag⁰) and partially oxidized (Ag⁺) silver species, indicating that some AgNPs undergo surface oxidation. This partial oxidation can influence their stability, surface reactivity, and potential applications in catalysis and biomedical fields.

Close

Figure 5.

XPS spectra of GBAg-NPs: (a) survey spectrum, (b) C 1s, (c) Ag 3d high-resolution spectra.

Export to PPT

3.8. GB-AgNPs inhibit the proliferation of glioma cells in vitro

In order to evaluate the cytotoxic profile of synthesized nanoparticles, we first tested the ability of GB-AgNPs to inhibit L929 (mouse fibroblast) in vitro (Figures 6a-g). The MTT assay, the gold standard for establishing IC50, was conducted for 24 h. The results showed that GB-AgNPs inhibited cell growth significantly, with an IC₅₀ of 78.66 ± 8.31 µg/mL in L929 cells. The photographs taken at different concentrations have shown clear signs of loss of cell adhesion, cell swelling, cell shrinkage, and loss of cellular extensions. This assay helps us gain a clear understanding of the general cytotoxicity and safety profile of the test compound. Testing on fibroblast cells helps identify if the compound is broadly toxic to healthy cells, which could indicate non-specific cytotoxicity or off-target effects. The observed selectivity of GB-AgNPs toward C6 glioma cells over L929 fibroblasts may be due to cancer-specific features such as higher metabolic rate, elevated oxidative stress, and increased nanoparticle uptake through endocytosis pathways, which make tumor cells more vulnerable to AgNP-induced ROS and mitochondrial damage. Normal fibroblasts, in contrast, maintain a tighter redox balance and exhibit less nanoparticle accumulation, which may underlie their lower sensitivity [21]. Meanwhile, dose-dependently, GB-AgNPs showed significant cytotoxicity in C6 cells (Figures 6h-n). The IC₅₀ obtained was 17.13 ± 1.08 µg/mL for 24 h. The assay revealed that the GB-AgNPs had higher cytotoxicity than that observed in fibroblasts, indicating the selectivity and low toxicity in healthy cells compared to cancer cells. Similar trends have been reported in previous nanoparticle studies [22].

Close

Figure 6.

Cytotoxicity of GB-AgNPs against cell lines by MTT assay. (a-f) represents the Control, 6.25, 12.5, 25, 50, and 100 µg/mL treatment, respectively, in the L929 cells. (g) represents the graphical representation of cytotoxicity in L929 cells. (h-m) represents the Control, 6.25, 12.5, 25, 50, and 100 µg/mL treatment, respectively, in the C6 cells. (n) represents the graphical representation of cytotoxicity in C6 cells. All experiments were done in triplicate, and results were represented as Mean ± SE.

Export to PPT

3.9. GB-AgNPs induced apoptosis in glioma cells through cell cycle arrest, caspase activation

Apoptosis is a programmed cell death process in which cells systematically die to maintain tissue health and development. It plays a critical role in eliminating damaged, redundant, or infected cells without causing inflammation. Triggered by internal or external signals, apoptosis involves a cascade of biochemical events, including cell shrinkage and DNA fragmentation. Dysregulation of apoptosis can lead to diseases like cancer or neurodegenerative disorders [23]. It is essential for the normal growth, immune function, and tissue homeostasis of multicellular organisms. Hence, the induction of apoptosis by any agent can be considered an effective tool in eliminating cancer cells. In the current research, we assessed the ability of nanoparticles to induce cell death through apoptosis using an Annexin V assay and flow cytometry to measure the apoptotic cell population. In Figure 7, the results of the analysis have been shown in Figures 7(a) (Control), 7(b) (12 h), and 7(c) (24 h). As shown in Figures 7(d), treatment with 17.13 μg/mL GB-AgNPs for 12 h increased the percentage of early apoptotic cells from 3.39 ± 0.25 to 21.13 ± 1.65%, with an overall total apoptosis population of 50.33 ± 7.15%. There is a time-dependent increase in the number of apoptotic cells observed at 24 h, with 58.06 ± 4.39% of total apoptotic cells. These findings are consistent with previous studies demonstrating that AgNPs induce apoptosis in various cancer cell lines, through oxidative stress and mitochondrial dysfunction [24,25].

Close

Figure 7.

(a-d) Cell apoptosis detected using Annexin V assay. (a) Control, (b) 12 h, (c) 24 h, and (d) percentage of apoptotic cell population quantified; (e,f) represent the cell cycle histograms of control and treatment, respectively. (g) Difference phases of the cell cycle were quantified; (h) ELISA analysis of caspase-3, -7, and -9 activation as markers for apoptosis. (EA: Early apoptosis, LA: Late apoptosis, D: dead cells, L: Live cells. TA: total apoptosis, C: Control, T: treatment, Cas: Caspases. * indicates p < 0.05 vs. control or untreated group).

Export to PPT

The observed apoptosis in our study is primarily mediated by a family of protease enzymes called caspases, as reported by various other researchers [26]. ELISA assays were performed to quantify the expression levels of active caspase-3, -7, and -9 in C6 cells treated with 17.13 μg/mL GB-AgNPs for 24 h to assess caspase activation. Compared to controls, GB-AgNP treatment significantly increased the expression of caspase-3, -7, and -9 (p < 0.05). The significant upregulation of all caspases studied showed that cell death and apoptosis occurred through a caspase-dependent pathway, probably the mitochondrial pathway. Caspase-9 is an initiator caspase, while caspases -3 and -7 are executioner caspases. The observed increase in active caspase levels aligns with studies reporting that AgNPs induce apoptosis in cancer cells by activating the mitochondrial pathway, leading to the release of cytochrome c and the formation of an apoptosome [27]. These findings are particularly relevant in the context of glioma, a highly aggressive cancer with limited therapeutic options due to its resistance to conventional treatments [28]. The ability of GB-AgNPs to activate multiple caspases suggests a significant apoptotic response that could overcome resistance mechanisms, such as caspase inhibition, often observed in glioma cells.

In a separate study, we carried out cell cycle analysis. The cells were treated with 17.13 μg/mL of GB-AgNPs, and the cell population in different phases was examined using propidium iodide (PI) staining. C6 cells treated at 24 h showed a significant accumulation in the G0/G1 phase, with 90.01 ± 6.5% of cells in G0/G1 compared to 58.42 ± 3.0% in untreated controls (p < 0.05, n = 3). On the other hand, the S phase population decreased from 9.8 ± 1.4% to 4.05 ± 0.9%, and the G2/M phase decreased to 7.5 ± 0.8 from 32.18 ± 1.08%. G0/G1 arrest induction may be mechanistically linked to apoptosis, as prolonged cell cycle arrest can trigger intrinsic apoptotic pathways [29]. For instance, p53-mediated G0/G1 arrest has been shown to activate BAX and BAX, pro-apoptotic proteins that promote mitochondrial outer membrane permeabilization and caspase activation [30].

3.10. GB-AgNPs induce anti-migration activity in glioma cells

In Figure 8, the wound healing migration assay was conducted to evaluate the effect of GB-AgNPs on cell migration over 72 h. At 0 h, the initial scratch width was consistent between the control (Figure 8a) and GB-AgNPs-treated (Figure 8e) groups. After 24 h, the control group (Figure 8b) showed a noticeable reduction in scratch width compared to the GB-AgNPs-treated group (Figure 8f), indicating faster cell migration in the control. At 48 h, the control group (Figure 8c) continued to exhibit greater scratch closure than the GB-AgNPs-treated group (Figure 8g). At 72 h, the control group (Figure 8d) nearly closed the scratch, while the drug-treated group (Figure 8h) showed significantly less closure, suggesting inhibition of cell migration by the drug. We have quantitatively analyzed the scratch area (Figure 8i), confirming these observations. There was a statistically significant difference (p < 0.05) in the areas measured in the treated groups compared to the controls. The ability of cancer cells to migrate and invade neighboring areas is a crucial step in cancer progression [31]. Hence, migration inhibition is crucial to any agent’s anti-cancer properties. Previously, AgNPs have been shown to have anti-migratory effects [32]. Together with the cell cycle arrest and anti-migratory effects observed in the current research, this highlights the anti-cancer potential of the synthesized AGNPs.

Close

Figure 8.

Wound healing scratch assay. Representative images from the assay demonstrate (a-c) gradual wound closure in control cells and (d) complete closure in, (e-h) while the wound closure in GB-AgNPs cells is incomplete. (i) The data were statistically significant at *p < 0.05 compared to the control at 24, 48, and 72 h. Data were represented as Mean ± SE. (C: Control; T: Treatment).

Export to PPT

3.11. GB-AgNPs altered the expression of p53, p21, and Bax genes in glioma cells

Earlier studies have shown that the activation of tumor suppressor and apoptosis genes plays a critical role in apoptosis and cell cycle arrest [33]. Hence, we conducted gene expression studies using real-time PCR to evaluate the expression of p53, p21, and BAX in GB-AgNPs-treated C6 cells. As shown in Figure 9, PCR analysis revealed significant changes in gene expression levels for Bax, p21, and p53 across control and treated samples. BAX expression increased from approximately 1.0-fold in the control to 2.0-fold in the treated samples, with a statistically significant difference. Similarly, the expression levels of p21 and p53 increased by approximately 2-fold in the treated samples compared to the control. These results indicate that GB-AgNP treatment induces a significant upregulation of the Bax, p21, and p53 genes in glioma cells.

Close

Figure 9.

Quantitative RT-PCR of p53, p21, and Bax gene expression. The expression levels of the gene are expressed in fold change. Data represent the mean ± SE. * indicates statistical significance at p < 0.05 compared to the control. C: Control; T: treatment.

Export to PPT

These results were aligned with the observed anticancer effects of GB-AgNPs, including induction of apoptosis, cell cycle arrest at the G0/G1 phase, and anti-migratory effects in the scratch wound healing assay. The significant upregulation of the Bax gene, a pro-apoptotic member of the Bcl-2 family, is a critical finding that confirms the observed induction of apoptosis in GB-AgNPs-treated C6 cells [34]. Bax promotes mitochondrial depolarization, which subsequently recruits apoptosome formation via the ApaF1 gene in mitochondrial pathways [8]. The 2-fold increase in GB-AgNPs induced C6 cells’ BAX expression, likely enhancing the Bax/Bcl-2 ratio, orienting the balance toward apoptosis. This was consistent with the observed upregulation of caspase-3, -7, and -9 downstream.

The upregulation of p21, a cyclin-dependent kinase inhibitor, supports and provides a molecular basis for the observed G0/G1 phase arrest. Theoretically, p21 inhibits the activity of cyclin-CDK complexes, which are essential for the G1 to S phase transition [35]. The role of p53 in p21 upregulation further strengthens this mechanism. Our study’s concurrent upregulation of p53 and p21 suggests that GB-AgNPs induced a p53-dependent stress response that activates p21, leading to cell cycle arrest. Furthermore, the upregulation of p53 likely contributes to the activation of BAX observed earlier. p53 has been shown to interact directly with the Bcl-2 family protein through its DNA-binding domain, leading to the sequestration of responsible proteins. This will facilitate the release of cytochrome c from mitochondria [36]. p53 has also been observed to regulate metastasis events in cancer [37]. We have observed a significant anti-migratory effect by GB-AgNPs, which could be due to p53 regulation. Studies have also shown that mutant p53 in cells supports higher migration and cell spreading [38].

It should be noted that the observed cytotoxic and anti-migratory effects are most likely attributable to the intrinsic activity of silver nanoparticles. While our FTIR and XPS analyses confirm the presence of phytochemical functional groups from Ginkgo biloba extract on the nanoparticle surface, their direct functional role in cytotoxicity cannot be concluded from the present study. Future studies would be required to isolate and characterize these capping agents to determine whether they contribute to the biological effects observed.