5.2
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
5.3
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
View/Download PDF

Translate this page into:

01 2023
:17;
105466
doi:
10.1016/j.arabjc.2023.105466

Inhibitory effect and mechanism of action of blue light irradiation on adipogenesis

Molecular Dermatology Laboratory, Department of Integrative Biotechnology, College of Biotechnology and Bioengineering, Sungkyunkwan University, Suwon City, 16419 Gyunggi Do, Republic of Korea
Department of Bio and Chemical Engineering, Hongik University, 30016 Sejong City, Republic of Korea
Integrative Research of T cells Laboratory, Department of Integrative Biotechnology, College of Biotechnology and Bioengineering, Department of Biopharmaceutical Convergence, Sungkyunkwan University, Suwon City, 16419 Gyunggi Do, Republic of Korea
Molecular Immunology Laboratory, Department of Integrative Biotechnology, College of Biotechnology and Bioengineering, Sungkyunkwan University, Suwon City, 16419 Gyunggi Do, Republic of Korea

⁎Corresponding authors. piscesmk@skku.edu (Minkyung Song), jaecho@skku.edu (Jae Youl Cho), bioneer@skku.edu (Jongsung Lee)

Disclaimer:
This article was originally published by Elsevier and was migrated to Scientific Scholar after the change of Publisher.
These authors contributed equally to this work.

Abstract

Blue light can reach the epidermis, dermis, and hypodermis of the skin and affect the physiology of each cell type. However, thus far, most studies have focused on the effects of blue light on the epidermis and dermis; no studies have been conducted on the effects of blue light on the hypodermis. In this study, we attempted to elucidate the effects of blue light on the hypodermis. Specifically, we investigated the effects of blue light on 3T3-L1 adipogenesis and its mechanism of action. In this study, we found that blue light reduced lipid accumulation and GPDH activity, indicating its antiadipogenic properties. Furthermore, blue light inhibited the mRNA and protein levels of peroxisome proliferator-activated receptor γ (PPARγ) and its target genes, such as Fasn and FABP4, and the luciferase activity of the PPRE promoter, suggesting that blue light downregulates the expression of adipogenic genes, leading to suppression of 3T3-L1 adipogenesis. Furthermore, blue light increased the phosphorylation of PPARγ, indicating its anti-adipogenic effect through PPARγ degradation. Blue light upregulates the expression and phosphorylation of transient receptor potential vanilloid 1 (TRPV1). Furthermore, blue light restored calcium influx, which was attenuated by adipogenesis. These data suggest that TRPV1 is involved in the anti-adipogenic effects of blue light. Blue light induced the phosphorylation of AMPK, ACC, and MAPKs, whereas capsazepine, an antagonist of TRPV1, attenuated the effects of blue light. Capsazepine treatment also reduced the blue light-induced anti-adipogenic effects. These results indicate that TRPV1 operates upstream of AMPK or MAPKs in the blue light-induced anti-adipogenesis process, which is mediated by activating the TRPV1-AMPK/MAPK signaling pathways. Meanwhile, inhibition of AMPK and MAPKs reduced the phosphorylation level of PPARγ, indicating that AMPK/MAPK signaling contributes to the phosphorylation of PPARγ. These results suggest the possibility of using blue light as an antiadipogenic agent.

Keywords

Blue light
Transient receptor potential cation channel subfamily V member 1 (TRPV1)
Adipogenesis
Peroxisome proliferator-activated receptor γ (PPARγ)
AMP-activated protein kinase (AMPK)
Mitogen-activated protein kinase (MAPK)

Abbreviations

TRPV1

Transient receptor potential cation channel subfamily V member 1

AMPK

AMP-activated protein kinase

ACC

Acetyl-CoA carboxylase

MAPK

Mitogen-activated protein kinase

ERK

Extracellular Signal-regulated kinase

JNK

c-Jun N-terminal kinase

GPDH

Glycerol-3-phosphate dehydrogenase

PPARγ

Peroxisome proliferator-activated receptor γ

Fasn

Fatty acid synthase

FABP4

Fatty acid-binding protein 4

C/EBPα

CCAAT/enhancer-binding proteins α

Ca2+

Calcium ion

UV

Ultraviolet

GLUT4

Glucose transporter type 4

DMEM

Dulbecco’s modified Eagle’s medium

DMSO

Dimethyl sulfoxide

FBS

Fetal bovine serum

PBS

Phosphate-buffered saline

qPCR

Quantitative polymerase chain reaction

SDS

Sodium dodecyl sulfate

BSA

Bovine serum albumin

RIPA

Radioimmunoprecipitation assay buffer

TBS

Tris-buffered saline

1

1 Introduction

Obesity has become one of the most severe social problems in recent decades. Obesity is associated with several chronic diseases including hyperlipidemia, hypertension, type 2 diabetes, sleep disorders, cardiovascular diseases, and arteriosclerosis (Guh et al., 2009, Pi-Sunyer, 2009, Payab et al., 2014, Payab et al., 2020). Thus, the amelioration of obesity, induced by adipogenesis (adipocyte growth) and lipogenesis (intracellular lipid accumulation), is regarded as a crucial task in modern society (Tang et al., 2003, Payab et al., 2020). Adipogenesis is the process by which preadipocytes differentiate into mature adipocytes. Insulin stimulates the activity of CCAAT/enhancer-binding protein α (C/EBPα) and peroxisome proliferator-activated receptor γ (PPARγ) to trigger adipogenesis. In mature adipocytes, triglycerides are synthesized and accumulated by the secretion of fatty acid synthase (Fasn) and transportation of fatty acid-binding protein 4 (FABP4), which are downstream targets of PPARγ (Ockner et al., 1972, Payab et al., 2020). PPARγ is a key transcriptional factor that controls glucose and the metabolism of fatty acids. PPARγ plays a pivotal role in increasing the expression of adipogenic genes and inducing the differentiation of preadipocytes into fully differentiated adipocytes by promoting the transcription of its target genes. In addition, PPARγ is an indispensable factor in maintaining the physiological function of mature adipocytes (Jiang et al., 2014). However, upon phosphorylation, PPARγ undergoes cytoplasmic degradation via poly-ubiquitination. This process suppresses the translocation of PPARγ into the nucleus and its binding with the peroxisome proliferator-response element (PPRE) promoter located in the PPARγ target genes (Moya and Marquez-Aguirre, 2016). Therefore, the induction of PPARγ phosphorylation may be an effective strategy for preventing obesity.

Sunlight, a major factor that affects the skin, can be categorized as ultraviolet (UV), visible, and infrared light based on its wavelength and amount of energy (Liebel et al., 2012, Moya and Marquez-Aguirre, 2016, Byrne et al., 2018, Park et al., 2022). Blue light, also known as high-energy visible (HEV) light, is emitted at wavelengths of 400–500 nm. Blue light is emitted not only from the sun, but also from digital devices, including televisions, smartphones, and computers (Schalka et al., 2019, Campiche et al., 2020, Park et al., 2022). Moreover, blue light has the shortest wavelength in the visible light spectrum, leading to a high-energy release. Hence, blue light can penetrate the skin deeper than UV light, indicating that blue light affects the adipose tissue in the hypodermis (the innermost layer of the skin) more effectively than UV light (Kang et al., 2018). Research on the effects of UV light irradiation on adipocytes has been widely reported; however, the effects of blue light irradiation on adipocytes remain unclear. In this study, we examined the effects of blue light on adipogenic differentiation.

Transient receptor potential vanilloid 1 (TRPV1) is a member of the transient receptor potential (TRP) cation channel family. TRPV1 is expressed in keratinocytes, kidney cells, melanocytes, sensory neurons, bronchial epithelial cells, and adipocytes (Lee et al., 2012, Chen et al., 2015, Caterina and Pang, 2016). The TRPV1 channel is controlled by capsaicin, the key component that imparts pungency to chili peppers. TRPV1 is also stimulated by heat (>43 °C), low pH (<4.5), and UV light (Tominaga and Tominaga, 2005). In our previous studies, we have shown that blue light induces intracellular calcium ion influx into human keratinocytes by promoting TRPV1 upregulation (Yoo et al., 2020, Park et al., 2022). In addition, TRPV1 has been suggested to be involved in adipogenesis (Zhang et al., 2007). However, the involvement of blue light in adipocyte biology has not been reported. Collectively, these two factors helped us develop our research hypotheses. One was a previous study by our research team on the relationship between blue light and TRPV1 and the other was a previous study on the relationship between TRPV1 and adipocyte differentiation. This motivated us to examine the effects of blue light on adipocyte biology and its underlying mechanisms of action.

AMP-activated protein kinase (AMPK) signaling contributes to the regulation of lipid metabolism, such as β-oxidation of fatty acids and lipolysis of triglycerides (Ma et al., 2015, Bu et al., 2019). The AMPK-dependent pathway is activated when AMPK is phosphorylated, leading to the suppression of lipogenesis, β-oxidation of fatty acids, and stimulation of lipolysis (Li et al., 2016, Bu et al., 2019). In addition, AMPK phosphorylation induces phosphorylation of PPARγ, transcription factors of adipogenic differentiation. Phosphorylation of PPARγ leads to suppression of the expression of adipogenic markers including glucose transporter type 4 (GLUT4), Fasn, and FABP4 (Lim et al., 2021). p38 mitogen-activated protein kinase (p38 MAPK), c-Jun N-terminal kinase (JNK), and extracellular signal-regulated kinase (ERK) are major regulators of several cellular events, such as cell proliferation, autophagy, and adipocyte differentiation (Lim et al., 2021, Yu et al., 2021). MAPKs are also involved in PPARγ phosphorylation.

In the present study, we examined the effects of blue light on adipogenesis and its mechanism of action in 3T3-L1 adipocytes. Specifically, we determined the link between TRPV1 signaling and the AMPK and MAPK signaling pathways in the context of the impact of blue light on adipogenesis.

2

2 Materials and methods

2.1

2.1 Antibodies

Antibodies were purchased from Invitrogen (Invitrogen, Waltham, MA, USA), Santa Cruz Biotechnology (Santa Cruz, Dallas, TX, USA), and Cell Signaling Technology (CST, Danvers, MA, USA). Invitrogen: TRPV1 (1:1000 dilution, PA1-29421), p-PPARγ (Ser112) (1:1000 dilution, PA5-36763), and p-TRPV1 (Ser502) (1:1000 dilution, PA5-64860); Santa Cruz Biotechnology: ERK 1/2 (1:2000, sc-292838), p-ERK 1/2 (Tyr 204), JNK (1:2000 dilution, sc-572), p-JNK (1:1000 dilution, sc-6254), p38 MAPK (1:1000 dilution, sc-535), PPARγ (E-8) (1:1000 dilution, sc-7273); Cell Signaling Technology: p-p38 MAPK (1:2000 dilution, 9216S), AMPKα (D5A2) (1:1000 dilution, 5831S), p-AMPKα (Thr172) (40H9) (1:1000 dilution, 2535S), Fasn (1:1000 dilution, 3189S), FABP4 (1:1000 dilution, 2120S), ACC (1:1000 dilution, 3662S) and p-ACC (Ser79) (1:1000 dilution, 3661S).

2.2

2.2 Condition for cell culture and differentiation

Mouse 3T3-L1 preadipocytes (ATCC, Manassas, VA, USA), a fibroblast cell line isolated from NIH/Swiss mouse embryos, were propagated in Dulbecco’s modified Eagle’s medium (DMEM; #SH30243.01, Hyclone, Logan, UT, USA) containing heat-inactivated newborn calf serum (10 %, HI NBCS, #26010–074, Life Technologies/Gibco, New-Zealand) and antibiotics (1 %, penicillin/streptomycin, Hyclone, South Logan, UT, USA, Cat. No. SH30010). These cells were cultured in a 5 % CO2 and 37 °C incubator, and the culture medium was replaced daily until the cells reached approximately 70–80 % confluence. Two days after the preadipocytes became confluent, the medium was replaced with Dulbecco’s modified eagle medium (DMEM) containing fetal bovine serum 10 % fetal bovine serum (FBS) (#FP-0500-A; Atlas, USA) and antibiotics (1 % penicillin/streptomycin) and incubated under the same conditions as those of the 3T3-L1 preadipocytes. After two days, adipogenic differentiation was stimulated by adding a differentiation initiation medium (day 0). The differentiation initiation medium is composed of DMEM (with 10 % FBS and 1 % antibiotics), and MDI cocktail [insulin (10 µg/mL, #I6634, Sigma-Aldrich, St. Louis, MO, USA), 3-isobutyl-1-methylxanthine (0.5 mM, IBMX, #I5879, Sigma-Aldrich, St. Louis, MO, USA), and dexamethasone (1 µM, DMS, #D4902, Sigma-Aldrich, St. Louis, MO, USA)]. After 2 days, the medium was replaced with a differentiation induction medium containing DMEM with 10 % FBS, 1 % antibiotics, and 10 µg/mL insulin, which was replaced every three days until the end of differentiation on day eight.

2.3

2.3 Blue light irradiation

A photoreactor (CCP-4 V; Luzchem, Ottawa, ON, Canada) was used to emit blue LED light at a wavelength of 470–480 nm. It provided irradiance of 76 W/m2 in the cells at 20 °C. The cells were irradiated with three doses — 76 W × 10 min/m2 (4.56 J/cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min) — each time before replacing the differentiation medium. Before irradiation with blue light, the differentiation medium was rinsed twice with phosphate-buffered saline at pH 7.4 (PBS, #SH30256. FS, Hyclone, Logan, UT, USA) and replaced with DMEM (without phenol red and sodium pyruvate) (#SH30284.02; Hyclone, Logan, UT, USA), containing 10 % FBS, 1 % antibiotics, and sodium pyruvate (1 mM, #P2256, Sigma-Aldrich, St. Louis, MO, USA). Furthermore, the experiment was conducted under identical conditions with the addition of phenol red-free medium to the negative and positive control groups and incubated in the dark at 20 °C while irradiating blue light on the experimental groups.

2.4

2.4 Protocol for oil red O staining

The 3T3-L1 cells were grown in 12-well plates. On the eighth day, after the initiation of differentiation and blue light irradiation, the cells were stained with the Oil Red O Stain Kit (#ORK-1, ScyTek). Briefly, the cells were rinsed with PBS thrice before every process, and all steps were conducted at 20 °C. The cells were fixed with 3 % paraformaldehyde (PFA, #30525–89-4; Duksan, Ansan, Korea) (diluted in PBS) for 20 min, and then incubated with propylene glycol for 5 min. Thereafter, the cells were incubated with Oil Red O solution for 1 h. Subsequently, the cells were treated with 85 % propylene glycol (diluted in distilled water) and incubated for 1 min. The nuclei of the cells were treated with hematoxylin for 1 min. Finally, images were analyzed and captured using the EVOS® FL cell imaging analysis system. Oil Red O dye was dissolved in 100 % isopropanol at room temperature for 5 min on a shaker at 100 rpm, and the supernatants were transferred into 96-well plates in triplicate. The absorbance of the samples was measured at 492 nm using a microplate reader. In addition, we treated the cells with capsazepine (#C191, Sigma-Aldrich, St. Louis, MO, USA) after irradiation with blue light to examine the effect of TRPV1 inhibition on lipid accumulation during cell differentiation.

2.5

2.5 Measurement of triglyceride contents

The total content of triglyceride was determined using a PicoSens™ Triglyceride Quantification Kit (Colorimetric/Fluorometric) (#BM-TGR-100; Biomax, Seoul, Korea). All the steps were performed according to the manufacturer’s protocol. Cells were grown in 60-well plates. On the eighth day after MDI cocktail treatment and blue light irradiation, the cells were rinsed, harvested with PBS, and then centrifuged at 12,000 rpm for 7 min. The cell pellets were suspended in 5 % NP-40 cell lysis buffer (#FNN0021, Thermo Fisher Scientific, Waltham, MA, USA) (diluted in distilled water), which included a phosphatase inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA, USA) and 3 % phenylmethylsulfonyl fluoride (PMSF, #329–98-6; Sigma-Aldrich, St. Louis, MO, USA) diluted in dimethyl sulfoxide (DMSO, #472301, Sigma-Aldrich, St. Louis, MO, USA). After heating the cells at 90 °C for 5 min, the cells were cooled to 20 °C. This process was repeated twice to solubilize the triglycerides. After centrifuging the cell suspensions at 13,000 rpm for 5 min, the supernatants were transferred into 96-well plates in triplicate and treated with triglyceride lipase (lyophilized) for 20 min at 20 °C for the breakdown of triglycerides. Next, the samples were treated with a reaction mix composed of triglyceride assay buffer, triglyceride enzyme mix (lyophilized), and triglyceride probe, and then maintained for 30 min in the dark. Finally, the absorbance of all samples was determined at 570 nm using a microplate reader to quantify the triglyceride levels of each sample. In this experiment, the total lipid content was determined from a standard curve obtained using a 0.2 mM triglyceride standard (diluted in the assay buffer). The triglyceride standard was diluted in the assay buffer to obtain final concentrations of 0, 2, 4, 6, 8, and 10 nmol/well, which were subjected to the process described above (from the step in which the samples were treated with lipase) in triplicate.

2.6

2.6 Assay for Glycerol-3-Phosphate dehydrogenase (GPDH) activity

The GPDH activity in 3T3-L1 cells was determined using a colorimetric GPDH assay kit (Colorimetric) (#ab174095; Abcam, Cambridge, UK). All the steps were performed according to the manufacturer’s protocol. Cells were grown in 60-well plates. On the eighth day after MDI cocktail treatment and blue light irradiation, the cells were washed, harvested with PBS, and then centrifuged at 12,000 rpm for 7 min. The cell pellets were suspended in the GPDH assay buffer, and the cells were pipetted up and down and left on ice for 5 min. This process was repeated 10–15 times to homogenize the cells. After centrifuging the cell suspensions at 12,000 rpm for 3 min at 4 °C, the supernatants and GPDH positive control, reconstituted with GPDH assay buffer, were transferred to 96-well plates in triplicate. Each well was treated with a reaction mixture composed of a GPDH assay buffer, GPDH substrate, and GPDH probe, and incubated for 1 h at 37 °C in the dark. The absorbance of all samples was determined at 450 nm using a microplate reader to quantify GPDH activity. The GPDH activity was determined from a standard curve obtained using a 1 mM NADH standard (diluted in assay buffer). The NADH standard was diluted in the assay buffer to obtain final concentrations of 0, 7.5, 15, 22.5, 30, and 37.5 nmol/well, which were subjected to the protocol described above (from the step where the samples were treated with the reaction mix) in triplicate. Additionally, we treated 3T3-L1 adipocytes with capsazepine after irradiation with blue light to examine the effects of TRPV1 inhibition on GPDH activity.

2.7

2.7 Measurement of protein expression with western blot

Cells were grown in 60-well plates. On the eighth day after MDI cocktail treatment and blue light irradiation, the cells were washed and harvested with PBS (ice-cold) and then centrifuged at 12,000 rpm for 7 min. After discarding the supernatant, the cell pellets were resuspended in RIPA lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA). The cells were pipetted up and down and left on ice for 5 min. This process was repeated five to six times to homogenize the cells. Next, the cell suspensions were pelleted by centrifugation at 17,000 rpm for 40 min at 4 °C, and the supernatants were transferred into new microtubes. The proteins in the supernatants were separated via 8–10 % SDS polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes (#162–0177, Bio-Rad, Hercules, California, USA). Membranes were blocked with 2 % bovine serum albumin (#A7906, Sigma-Aldrich, St. Louis, MO, USA) for 1 h. The membranes were then treated with primary antibodies overnight at 4 °C. The membranes were rinsed thrice with Tris-buffered saline (TBS) containing Tween 20 (#T1027, Biosesang, Seongnam, Korea). After washing, the membranes were treated with secondary antibodies for 1–2 h at 20 °C. The band intensity and pattern of each sample were determined using an ECL (enhanced chemiluminescence) western blotting reagent (#170–5061, Bio-Rad, California, USA). Additionally, we treated 3T3-L1 cells with capsazepine after irradiation with blue light to investigate the effect of TRPV1 inhibition on the molecules downstream of TRPV1. Furthermore, we treated the cells with PD0325901 (ERK inhibitor, #PZ0162, Sigma-Aldrich, St. Louis, MO, USA), SP600125 (JNK inhibitor, #S5567, Sigma-Aldrich, St. Louis, MO, USA), and SB203580 (p38 inhibitor, #S8307, Sigma-Aldrich, St. Louis, MO, USA) after irradiation with blue light to investigate the effect of MAPK inhibition on the phosphorylation level of PPARγ. Moreover, we treated cells with compound C (AMPK inhibitor, #171260, Sigma-Aldrich, St. Louis, MO, USA) after irradiation with blue light to examine the effect of AMPK inhibition on PPARγ expression.

2.8

2.8 Quantitative PCR analysis

Expression of PPARγ, a key regulator of adipogenic differentiation, and its target genes (Fasn, FABP4, etc.) was measured by qPCR. Cells were cultured in 60-well plates. Eight days after initiating differentiation and blue light irradiation, RNA was extracted from 3T3-L1 cells using the TRI reagent® (#79306, QIAGEN, Hilden, Germany), according to the manufacturer’s protocols. Similarly, complementary DNA was synthesized from mRNA with TOPscript™ RT DryMIX (#RT200, Enzynomics, Daejeon, Korea) in accordance with the manufacturer’s protocols. cDNA amplification was performed using the AllInOneCycler™ PCR system (Bioneer) following the manufacturer’s protocols. The specific conditions used are as follows: denaturation at 94 °C for 300 s and 30 cycles of 94 °C for 15 s, 62 °C for 30 s, and 72 °C for 20 s. The expression was normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The results were visualized under UV light irradiation. Table 1 lists the primer sequences used for qPCR.

Table 1 Sequences of primers used in qPCR.
Gene Forward (5ʹ→ 3ʹ) Reverse (5ʹ→ 3ʹ)
PPARγ TTTTCCGAAGAACCATCCGATT ATGGCATTGTGAGACATCCCC
Fasn GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG
FABP4 AAGGTGAAGAGCATCATAACCCT TCACGCCTTTCATAACACATTCC

Primers for mouse PPARγ (accession number: NM_001127330), Fasn (accession number: NM_007988.1), and FABP4 (accession number: NM_024406.1) were used.

2.9

2.9 Assay for PPRE luciferase reporter assay and β-galactosidase

The cells were cultured in 6-well plates and incubated at 37 °C for two days. The cells were then co-transfected with PPRE-luciferase reporter plasmid (1 μg, Addgene, MA, USA) along with β-galactosidase plasmid (1 μg, Promega Corporation) using polyethyleneimine (PEI) (5 μg, #23996–2, Polysciences, Inc., Warrington, USA) in medium without serum and incubated at 37 °C overnight. The cells were then irradiated with blue light and incubated with the MDI cocktail in a fresh medium for 24 h at 37 °C. The cells were collected in PBS and centrifuged at 13,000 rpm for 6 min. The cell pellets were suspended and lysed in Reporter Lysis Buffer (E3971; Promega, Madison, WI, USA), frozen at –80 °C for 20 min, and thawed at 20 °C. Then, the cells were centrifuged at 11,320 rpm for 5 min at 4 °C, and the supernatants were added to 96-well plates. Luciferase enzyme activity and β-galactosidase activity were determined as per the manufacturer’s instructed protocol (Promega Corporation). Luciferase reporter activity of the PPRE promoter was normalized to that of β-galactosidase.

2.10

2.10 Fluo-4 NW Ca2+ influx assay

A Fluo-4 NW assay kit (F36206; Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) was used for all experiments. The cells were seeded in 96-well microplates with black walls/clear bottoms. On the eighth day after the induction of differentiation and blue light (4.56 J/cm2) irradiation, the cells were rinsed with assay buffer and incubated with 1X Fluo-4 NW reagent loading solution. Blue light was only used in the blue light irradiation group. The cells were maintained at 37 °C for 30 min, and at 20 °C in the dark for 30 min. Finally, the absorbance of all groups was determined at 494 nm (excitation wavelength) and 516 nm (emission wavelength) using a microplate reader to analyze the intracellular calcium influx. Additionally, we treated 3T3-L1 cells with capsazepine after irradiation with blue light to examine the effects of TRPV1 inhibition on calcium influx.

2.11

2.11 Statistical analysis

Data are presented as mean ± standard error of the mean (SEM). Student’s t-test was used to determine differences between the two groups. Differences between multiple groups were evaluated by one-way analysis of variance (ANOVA), and Tukey’s multiple comparison test using GraphPad Prism (5.0) software (GraphPad, La Jolla, CA, U.S.A.).

3

3 Results

3.1

3.1 Blue light inhibits cellular adipogenesis

We examined the anti-adipogenic effects of blue light during the differentiation of 3T3-L1 preadipocytes into mature adipocytes. Oil Red O staining, triglyceride assays, and glutathione peroxidase (GPDH) activity assays were performed to demonstrate the effects of blue light on adipogenic inhibition. Two days after the 3T3-L1 preadipocytes reached approximately 70–80 % confluence, they were irradiated with blue light for 10, 15, and 30 min before changing the differentiation medium. Oil Red O staining was performed on the eighth day after initiating cell differentiation to examine the proportion of intracellular lipid droplets. Compared to that in undifferentiated cells, lipid accumulation in fully differentiated cells increased significantly. Lipid accumulation in differentiated cells exposed to blue light significantly reduced in a time-dependent manner (Fig. 1A). To further test the hypothesis that blue light inhibits adipocyte differentiation, we measured the intracellular levels of GPDH activity and triglyceride content. The triglyceride levels of cells treated with the differentiation cocktail were much higher than those of undifferentiated cells. However, blue light irradiation during adipogenesis of 3T3-L1 preadipocytes reduced the intracellular triglyceride content in a time-dependent manner (Fig. 1B). Evaluation of GPDH activity showed the same trend, as shown in Fig. 1A and 1B. Compared with pre-adipocytes, the GPDH activity of mature adipocytes was greatly enhanced, but blue light repressed GPDH activity in mature adipocytes. These data indicated that blue light suppressed adipogenic differentiation by inhibiting cellular lipid droplet accumulation and GPDH activity.

Blue light inhibits 3T3-L1 adipogenesis. Each time, before differentiation medium replacement, the confluent 3T3-LI cells preadipocytes (approximately 70–80 % confluent were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min)). Undifferentiated cells were used as a negative control, and cells treated with a differentiation cocktail were used as a positive control. The assays were conducted on the eighth day after differentiation initiation. (A) Oil Red O staining of lipid droplets. (B) Total level of intracellular triglycerides. (C) GPDH activity in the 3T3-L1 cells. Results are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0 0.01, ###p < 0 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 1
Blue light inhibits 3T3-L1 adipogenesis. Each time, before differentiation medium replacement, the confluent 3T3-LI cells preadipocytes (approximately 70–80 % confluent were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min)). Undifferentiated cells were used as a negative control, and cells treated with a differentiation cocktail were used as a positive control. The assays were conducted on the eighth day after differentiation initiation. (A) Oil Red O staining of lipid droplets. (B) Total level of intracellular triglycerides. (C) GPDH activity in the 3T3-L1 cells. Results are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0 0.01, ###p < 0 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.2

3.2 Blue light promotes the degradation of PPARγ protein by inducing PPARγ phosphorylation

PPAR-γ is an important regulator of adipogenic differentiation. When PPARγ moves into the nucleus and binds to PPRE in the target molecules of PPARγ, it stimulates the transcription of PPARγ-downstream targets such as Fasn and FABP4. Phosphorylation of PPARγ induces proteasomal degradation in the cytosol, preventing nuclear translocation of PPARγ (Moya and Marquez-Aguirre, 2016). PPARγ expression in mature adipocytes was much higher than that in preadipocytes. In contrast, the protein level of PPARγ in 3T3-L1 mature adipocytes treated with blue light three times during adipogenesis was time-dependently downregulated. Moreover, the phosphorylation level of PPARγ was decreased by treatment with the MDI cocktail and was recovered upon exposure to blue light (Fig. 2A). The transcriptional level of PPARγ showed the same trend as the PPARγ protein expression (Fig. 2B). Similarly, the activity of the PPRE-luciferase reporter increased when adipogenesis was initiated but was suppressed by blue light irradiation in a time-dependent manner (Fig. 2C). Taken together, blue light inhibits the expression and transcriptional activity of PPARγ; however, it upregulates PPARγ phosphorylation. Moreover, blue light inhibits the luciferase activity of PPRE. These results indicated that blue light irradiation lowered the expression and transcriptional activity of PPARγ. Furthermore, blue light blocked the differentiation of 3T3-L1 preadipocytes by promoting the phosphorylation of PPARγ, leading to the degradation of PPARγ protein.

Blue light promotes the degradation of PPARγ protein by inducing PPARγ phosphorylation in 3T3-L1 cells. Each time, before differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min). The undifferentiated cells were used as a negative control, and the fully differentiated cells were used as a positive control. (A) Western blotting analysis of PPARγ and its phosphorylated form on the eighth day after differentiation initiation. (B) Quantitative PCR analysis of the mRNA level of PPARγ on the eighth day after differentiation initiation. (C) The confluent 3T3-L1 cells (approximately 70–80 % confluence) were transfected with PPRE-luciferase reporter plasmid and β-galactosidase. The cells were exposed to blue light the next day at three doses. The undifferentiated cells were used as a negative control, and the fully differentiated cells were used as a positive control. Then, the cells were treated with an MDI cocktail and incubated for 24 h to induce differentiation. Finally, the adipocytes were harvested and used to perform a luciferase reporter assay for evaluating the luciferase activity of PPRE. The results are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 2
Blue light promotes the degradation of PPARγ protein by inducing PPARγ phosphorylation in 3T3-L1 cells. Each time, before differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min). The undifferentiated cells were used as a negative control, and the fully differentiated cells were used as a positive control. (A) Western blotting analysis of PPARγ and its phosphorylated form on the eighth day after differentiation initiation. (B) Quantitative PCR analysis of the mRNA level of PPARγ on the eighth day after differentiation initiation. (C) The confluent 3T3-L1 cells (approximately 70–80 % confluence) were transfected with PPRE-luciferase reporter plasmid and β-galactosidase. The cells were exposed to blue light the next day at three doses. The undifferentiated cells were used as a negative control, and the fully differentiated cells were used as a positive control. Then, the cells were treated with an MDI cocktail and incubated for 24 h to induce differentiation. Finally, the adipocytes were harvested and used to perform a luciferase reporter assay for evaluating the luciferase activity of PPRE. The results are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.3

3.3 Effect of blue light on PPARγ downstream targets

Fasn and FABP4 are typical adipogenic genes activated mainly via PPARγ induction. The expression levels of Fasn and FABP4 were examined on day 8 after the induction of cell differentiation. Blue light attenuated the differentiation cocktail-induced increases in FASN and FABP4 mRNA levels (Fig. 3A). Similarly, exposure to blue light reduced Fasn and FABP4 protein levels, which were increased by the differentiation medium (Fig. 3B). These findings imply that blue light exerts an inhibitory effect on the downstream targets of PPARγ, such as Fasn and FABP4, through the inhibition of the PPARγ signaling pathway, as shown in Fig. 2A and Fig. 2B.

Effect of blue light on PPARγ downstream targets. Each time, before differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min). The undifferentiated cells were used as a negative control, and the fully differentiated cells were used as a positive control. (A) Quantitative PCR analysis of the mRNA levels of Fasn and FABP4 on the eighth day after differentiation initiation. (B) Western blotting analysis of Fasn and FABP4 on the eighth day after differentiation initiation. The results are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 3
Effect of blue light on PPARγ downstream targets. Each time, before differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min). The undifferentiated cells were used as a negative control, and the fully differentiated cells were used as a positive control. (A) Quantitative PCR analysis of the mRNA levels of Fasn and FABP4 on the eighth day after differentiation initiation. (B) Western blotting analysis of Fasn and FABP4 on the eighth day after differentiation initiation. The results are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.4

3.4 Blue light recovers TRPV1 expression and calcium influx in adipocyte differentiation

It has already been reported that the TRPV1 channel is involved in adipogenic differentiation (Zhang et al., 2007). In a previous study, we showed that blue light regulates the activation and expression of TRPV1 in human keratinocytes and contributes to increased cellular calcium influx [18]. Therefore, we hypothesized that blue light would recover the expression of TRPV1 and that intracellular calcium influx would be inhibited by adipogenic differentiation. We found that protein expression of TRPV1 decreased in cells treated with the differentiation cocktail, whereas it increased upon irradiation with blue light in a time-dependent manner (Fig. 4A). The levels of the phosphorylated form of TRPV1 showed a trend similar to that of TRPV1. The phosphorylation level of TRPV1 was repressed during adipogenesis and was reversed by exposure to blue light for 15 and 30 min (Fig. 4B). Additionally, we found that the cellular influx of calcium was attenuated by adipogenic differentiation but was enhanced again by 10 min irradiation with blue light. However, the recovery of calcium influx by blue light irradiation was reduced by co-treatment with capsazepine, a TRPV1 antagonist (Fig. 4C). These results indicate that blue light irradiation restores TRPV1 expression, leading to the stimulation of intracellular calcium influx in 3T3-L1 adipocytes.

Blue light recovers TRPV1 expression and calcium influx during 3T3-L1 adipocyte differentiation. Each time, before differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min). The undifferentiated cells were used as a negative control, and the fully differentiated cells were used as a positive control. (A-B) Western blotting analysis of TRPV1 and its phosphorylated form on the eighth day after differentiation initiation. (C) Each time, prior to the differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at 4.56 J/cm2. The cells were co-treated with capsazepine (10 μM) and the differentiation cocktail. Analysis of calcium influx was performed on the eighth day. The results are shown as mean ± SEM in at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 4
Blue light recovers TRPV1 expression and calcium influx during 3T3-L1 adipocyte differentiation. Each time, before differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min). The undifferentiated cells were used as a negative control, and the fully differentiated cells were used as a positive control. (A-B) Western blotting analysis of TRPV1 and its phosphorylated form on the eighth day after differentiation initiation. (C) Each time, prior to the differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at 4.56 J/cm2. The cells were co-treated with capsazepine (10 μM) and the differentiation cocktail. Analysis of calcium influx was performed on the eighth day. The results are shown as mean ± SEM in at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.5

3.5 Effect of TRPV1 ablation on intracellular levels of GPDH activity and lipid accumulation

In our previous experiments, we found that TRPV1 might be involved in the anti-adipogenic effects of blue light. To verify the contribution of TRPV1 to blue light-induced inhibition of adipogenesis, capsazepine, a well-known TRPV1 agonist, was used for Oil Red O staining and GPDH activity assays. As shown in Fig. 5A, lipid droplets stained with Oil Red O were denser in fully differentiated cells than in undifferentiated cells. Blue light suppresses lipid formation during adipogenesis, whereas capsazepine restores it. Additionally, the increased GPDH activity induced by the MDI cocktail was blocked by exposure to blue light; however, capsazepine enhanced GPDH activity (Fig. 5B). These data indicate that TRPV1 is directly associated with the attenuation of adipocyte differentiation by blue light.

Effect of TRPV1 ablation on intracellular lipid accumulation and GPDH activity. Each time, prior to the differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at 13.68 J cm−2. The cells were co-treated with capsazepine (10 μM) and the differentiation cocktail. Preadipocytes were used as a negative control, and mature adipocytes were used as a positive control. The assays were performed on the eighth day after differentiation initiation. (A) Oil Red O staining of lipid accumulation in the cells. (B) GPDH activity of 3 T3-LI cells. The results are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 5
Effect of TRPV1 ablation on intracellular lipid accumulation and GPDH activity. Each time, prior to the differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at 13.68 J cm−2. The cells were co-treated with capsazepine (10 μM) and the differentiation cocktail. Preadipocytes were used as a negative control, and mature adipocytes were used as a positive control. The assays were performed on the eighth day after differentiation initiation. (A) Oil Red O staining of lipid accumulation in the cells. (B) GPDH activity of 3 T3-LI cells. The results are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.6

3.6 Blue light increases the intracellular phosphorylation levels of MAPK and AMPK

MAPK pathway proteins (p38, JNK, and ERK) contribute to various cellular processes, including transcription, DNA replication, and differentiation (Lim et al., 2021, Yu et al., 2021). AMPK signaling is also associated with lipid metabolism, including lipolysis of triglycerides and β-oxidation of fatty acids (Ma et al., 2015, Bu et al., 2019). Activation of AMPK and its downstream signaling, acetyl-CoA carboxylase (ACC), is induced when the proteins are phosphorylated and contribute to the suppression of adipogenesis by inhibiting key proteins (PPARγ and C/EBPα), which are transcription factors involved in adipogenic differentiation (Lim et al., 2021). In this study, the phosphorylation levels of MAPKs, AMPK, and ACC were measured in 3T3-L1 cells by western blotting. Blue light did not alter the total expression of total ERK, JNK, and p38. Compared to undifferentiated cells, the phosphorylation levels of MAPKs were noticeably decreased in differentiated cells. In contrast, levels of phosphorylated MAPKs increased after exposure to blue light during adipogenesis (Fig. 6A). The phosphorylation levels of AMPK and ACC were also reduced upon differentiation induction and recovered upon blue light irradiation (Fig. 6B). Therefore, the results proved that blue light activates the MAPK and AMPK signaling pathways.

Blue light increases the phosphorylation of MAPK and AMPK in 3T3-L1 cells. Each time, before differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min). The preadipocytes were used as a negative control, and the mature adipocytes were used as a positive control. (A-B) Western blotting analysis of MAPKs, AMPK, and ACC and their phosphorylated forms on the eighth day after differentiation initiation. The data are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 6
Blue light increases the phosphorylation of MAPK and AMPK in 3T3-L1 cells. Each time, before differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at three doses: 76 W × 10 min/m2 (4.56 J /cm2 for 10 min), 76 W × 15 min/m2 (6.84 J/cm2 for 15 min), and 76 W × 30 min/m2 (13.68 J/cm2 for 30 min). The preadipocytes were used as a negative control, and the mature adipocytes were used as a positive control. (A-B) Western blotting analysis of MAPKs, AMPK, and ACC and their phosphorylated forms on the eighth day after differentiation initiation. The data are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.7

3.7 Effect of TRPV1 inhibition on MAPK and AMPK signalings

In previous experiments, we demonstrated that blue light activates the TRPV1 channel as well as MAPKs and AMPK. Therefore, we examined the relationship between TRPV1, MAPKs, and AMPK. As shown in Fig. 7A, although the phosphorylation levels of p38 MAPK, JNK, and ERK were decreased in the differentiation medium, blue light increased their phosphorylation levels. However, treatment with capsazepine blocked this effect. AMPK signaling also showed results similar to those of MAPKs (Fig. 7B). These results indicated that TRPV1 inhibition reduced the phosphorylation levels of MAPK, AMPK, and ACC proteins, leading to a disturbance in the anti-adipogenic effect of blue light. In addition, these results suggest that TRPV1 operates upstream of AMPK and MAPKs in blue-light-induced effects.

Effect of TRPV1 inhibition on MAPK and AMPK signaling pathways. Each time, prior to the differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at 13.68 J cm−2. The cells were co-treated with capsazepine (10 μM) and the differentiation cocktail. Preadipocytes were used as a negative control, and mature adipocytes were used as a positive control. (A-B) Western blotting analysis of MAPKs, AMPK, and ACC and their phosphorylated forms on the eighth day after differentiation initiation. The data are represented as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 7
Effect of TRPV1 inhibition on MAPK and AMPK signaling pathways. Each time, prior to the differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at 13.68 J cm−2. The cells were co-treated with capsazepine (10 μM) and the differentiation cocktail. Preadipocytes were used as a negative control, and mature adipocytes were used as a positive control. (A-B) Western blotting analysis of MAPKs, AMPK, and ACC and their phosphorylated forms on the eighth day after differentiation initiation. The data are represented as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.8

3.8 Inhibition of AMPK and MAPK downregulates PPARγ phosphorylation level

Previous results have reported that AMPK and MAPKs induce the phosphorylation of PPARγ, contributing to its degradation (Moya and Marquez-Aguirre, 2016). In addition, we demonstrated the activation of AMPK-MAPK signaling pathways and the suppression of PPARγ expression and phosphorylation by blue light. Therefore, to test whether AMPK and MAPK suppress PPARγ, SP600125 (inhibitor of JNK), PD0325901 (inhibitor of ERK), SB203580 (inhibitor of p38), and compound C (AMPK inhibitor) were used for western blot analysis. As shown in Fig. 8A, protein levels of PPARγ in mature adipocytes increased remarkably compared to that in preadipocytes but decreased in cells exposed to blue light for 30 min. However, the group treated with SP600125, PD0325901, SB203580, and compound C showed recovery from the blue light-induced reduction of PPARγ. In contrast, phosphorylated PPARγ levels were reduced by adipogenesis induction, whereas they were recovered by blue light irradiation. However, the phosphorylation level of PPARγ was reduced by inhibiting ERK, JNK, p38 MAPK, and AMPK (Fig. 8A and Fig. 8B). These data indicate that AMPK and MAPKs activation have negative impacts on PPARγ protein level but positively affect PPARγ phosphorylation in the blue light-induced anti-adipogenesis.

Inhibition of AMPK and MAPK downregulates PPARγ phosphorylation level. Each time, prior to the differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at 13.68 J cm−2. The cells were co-treated with the differentiation cocktail and Compound C (10 μM), PD0325901 (10 μM), SP600125 (20 μM), or SB203580 (10 μM). Preadipocytes were used as a negative control and mature cells were used as a positive control. (A-B) Western blotting analysis of PPARγ and its phosphorylated form on the eighth day after differentiation initiation. The data are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 8
Inhibition of AMPK and MAPK downregulates PPARγ phosphorylation level. Each time, prior to the differentiation medium replacement, the confluent 3 T3-LI cells preadipocytes (approximately 70–80 % confluent) were irradiated with blue light at 13.68 J cm−2. The cells were co-treated with the differentiation cocktail and Compound C (10 μM), PD0325901 (10 μM), SP600125 (20 μM), or SB203580 (10 μM). Preadipocytes were used as a negative control and mature cells were used as a positive control. (A-B) Western blotting analysis of PPARγ and its phosphorylated form on the eighth day after differentiation initiation. The data are shown as mean ± SEM of at least three different experiments. #: vs preadipocytes, *: vs mature adipocytes, #p < 0.05, ##p < 0.01, ###p < 0.001, *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

4

4 Discussion

Obesity is a major global social issue. Obesity is associated with several metabolic diseases, including arteriosclerosis, cardiovascular disease, and type 2 diabetes (Guh et al., 2009, Pi-Sunyer, 2009, Payab et al., 2014, Payab et al., 2020). Obesity typically occurs through the sequential processes of adipocyte formation, proliferation, and differentiation (Oh et al., 2018). Today, inhibition of adipogenic differentiation is on the rise as an essential strategy for improving obesity.

Sunlight is divided into infrared, visible, and ultraviolet. Blue light (high-energy visible (HEV) light) is short-wavelength light with high energy in the 380–500 nm range of visible light. In addition, LED lights such as smartphones, tablet PCs, TV screens, and monitors emit blue light, which can be detrimental to the health of people who spend more than 12 h a day using digital devices. Negative effects of blue light on the skin have been widely suggested, including reducing proliferation and inducing oxidative stress in human keratinocytes (Park et al., 2022), whereas few reports have suggested beneficial effects of blue light on the skin. In our previous study, blue light was shown to play a role in the upregulation of TRPV1 in epithelial cells. The TRPV1 channel is generally activated by high temperature, low pH, and capsaicin, an active component of chili peppers, leading to the enhancement of intracellular calcium ion levels in cells such as kidney cells, bronchial epithelial cells, sensory nerves, and adipose cells (Yoo et al., 2020). Adipose cells form adipose tissue in the subcutaneous layer, which is the deepest layer of the skin. TRPV1 is also suggested to be involved in adipose cell differentiation (Moya and Marquez-Aguirre, 2016). Therefore, based on our previous studies on the relationship between blue light and TRPV1 and existing reports on the relationship between TRPV1 and adipocyte differentiation, we evaluated in the present study the effects of blue light on adipocyte differentiation and its mechanisms of action.

The TRPV1 channel plays multiple roles in obesity, including the regulation of lipid homeostasis, improvement of diabetes, and amelioration of hypertension (Sun et al., 2013). In our previous studies, we showed that blue light stimulates the expression of TRPV1, resulting in the induction of intracellular calcium influx into other skin cells, such as keratinocytes (Yoo et al., 2020, Park et al., 2022). In this study, we confirmed that blue light induces activation of the TRPV1 receptor in 3T3-L1 mouse cells as well as phosphorylation of the TRPV1 channel. In addition, the MDI cocktail-induced inhibition of calcium influx was reversed by TRPV1 activation stimulated by blue light irradiation. These results indicate that blue light-induced anti-adipogenesis involves TRPV1 signaling in adipocytes.

GPDH promotes the formation of glycerol-3-phosphate and regulates lipid metabolism (Zhao et al., 2018). The GPDH enzyme is involved in triglyceride synthesis and the conversion of adipose cells, both morphologically and characteristically (Kozak and Jensen, 1974, Lee et al., 2009). In this study, we confirmed that blue light greatly reduces both intracellular triglyceride accumulation and GPDH activity in 3T3-L1 mature cells. These results demonstrated the inhibitory effect of blue light on adipogenic differentiation. In addition, we examined the involvement of TRPV1, the main molecule activated by blue light, in blue light-induced inhibition of adipogenesis. In this study, we found that the suppression of TRPV1 by capsazepine, an antagonist of TRPV1, interfered with the blue light-induced inhibition of differentiation. These results indicate that the anti-adipogenic effect of blue light occurs through TRPV1 channel activation.

Adipogenesis is closely associated with the activity of adipocyte-specific genes, including PPARγ. PPARγ is a transcription factor with ligand-dependence and belongs to the nuclear hormone receptor gene superfamily (Peverelli et al., 2013). PPARγ is widely known to be a major regulator of adipogenic differentiation. In addition, PPARγ has the potential to drive adipogenic differentiation by expressing downstream targets, such as Fasn and FABP4. Fasn is involved in the synthesis of fatty acids, and FABP4 plays a critical role in transporting fatty acids within cells (Soret et al., 2016). Therefore, developing a therapeutic agent targeting PPARγ may be an effective strategy for obesity prevention. In contrast, phosphorylation of PPARγ causes degradation of the protein through polyubiquitination; therefore, the phosphorylated form of PPARγ can be conjugated as a novel PPARγ inhibitor (Moya and Marquez-Aguirre, 2016). In this study, we found that PPARγ expression was suppressed by exposure to blue light. We also found that the luciferase activity of PPRE, a promoter of PPARγ target genes that forms a complex with PPARγ in the nucleus, is decreased by blue light irradiation. Furthermore, the mRNA and protein levels of PPARγ target molecules FASN and FABP4 were attenuated by blue light irradiation. However, the phosphorylation level of the PPARγ protein shows an opposite trend to the expression of PPARγ. These results suggest that blue light can act as a potential inhibitor of PPARγ and its target molecules by stimulating the phosphorylation or lowering the expression of the gene.

ERK, JNK, and p38 are widely known to be involved in adipogenesis (Oh et al., 2018). Although there have been differences in opinions regarding the positive and negative effects of MAPKs on adipogenesis, the phosphorylation of MAPK proteins, particularly ERK and JNK, contributes to the phosphorylation of PPARγ (Moya and Marquez-Aguirre, 2016). AMPK is an important modulator of energy homeostasis in adipose cells. According to several studies, in adipose tissue, the phosphorylation of AMPK stimulates catabolic pathways, including the breakdown of glucose, fatty acid oxidation, and energy expenditure via lipolysis (Oh et al., 2018, Lim et al., 2021, Yang et al., 2021). In addition, phosphorylated forms of AMPK and its substrate ACC are involved in increasing the phosphorylation of PPARγ (Xu et al., 2021). Therefore, in this study, we hypothesized that the induction of MAPKs and AMPK phosphorylation may be a crucial upstream event in the blue light-mediated inhibition of 3T3-L1 preadipocyte differentiation. In this study, we found that blue light influenced the activation of AMPK, ERK, JNK, and p38, leading to attenuation of adipogenic differentiation by increasing the phosphorylation level of PPARγ. In addition, blue light-induced phosphorylation of AMPK and MAPKs was attenuated by capsazepine treatment. These results indicate that blue light regulates adipogenesis through TRPV1-dependent activation of MAPKs and AMPK.

Taken together, these findings indicate that blue light inhibits adipogenic differentiation and that its anti-adipogenic effect is mediated through TRPV1-dependent activation of the AMPK and MAPK signaling pathways (Fig. 9). These results suggest that blue light could be a therapeutic agent for improving obesity-associated disorders. However, as these findings were demonstrated through in vitro research using mouse cell line, additional research, including clinical trials in animals and humans, is necessary to verify the clinical applicability and safety of blue light irradiation.

Schematic diagram showing the action mechanism of blue light-induced anti-adipogenesis in 3T3-L1 cells. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 9
Schematic diagram showing the action mechanism of blue light-induced anti-adipogenesis in 3T3-L1 cells. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

5

5 Conclusion

This is the first study to report the anti-adipogenic effect of blue light, along with its anti-adipogenic mechanism, in a mouse preadipocyte cell line. Specifically, blue light negatively regulates adipogenesis, and its anti-adipogenic effect is mediated through TRPV1-dependent activation of the AMPK and MAPK signaling pathways. This study also suggests that blue light can be used as a therapeutic agent to treat obesity-associated disorders.

Funding

This research was supported by a grant from the Medical Device Technology Development Program (Grant No. 20008861) funded by the Ministry of Trade, Industry, and Energy (MOTIE), Republic of Korea, and a grant from the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science and Technology Information and Communication (Grant No. RS-2023-00246887).

CRediT authorship contribution statement

Seoyoun Yang: Conceptualization, Methodology, Formal analysis, Writing – original draft. Eunbi Yu: Conceptualization, Methodology, Formal analysis, Writing – original draft. See-Hyoung Park: Conceptualization, Methodology, Formal analysis, Writing – original draft. Sae Woong Oh: Conceptualization, Methodology. Kitae Kwon: Conceptualization, Methodology. Su Bin Han: Conceptualization, Methodology. Soo Hyun Kang: Conceptualization, Methodology. Jung Hyun Lee: Conceptualization, Methodology. Heejun Ha: Conceptualization, Methodology. Minkyung Song: Conceptualization, Methodology, Formal analysis, Writing – original draft. Jae Youl Cho: Conceptualization, Methodology, Formal analysis, Writing – original draft, Funding acquisition, Supervision, Writing – review & editing. Jongsung Lee: Conceptualization, Methodology, Formal analysis, Writing – original draft, Funding acquisition, Supervision, Writing – review & editing.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. , , , . Bilobalide Suppresses Adipogenesis in 3T3-L1 Adipocytes via the AMPK Signaling Pathway. Molecules. 2019;24
    [CrossRef] [Google Scholar]
  2. , , , . Recent advances in photocatalysis for environmental applications. J. Environ. Chem. Eng.. 2018;6:3531-3555.
    [Google Scholar]
  3. , , , . Pigmentation effects of blue light irradiation on skin and how to protect against them. Int. J. Cosmet. Sci.. 2020;42:399-406.
    [CrossRef] [Google Scholar]
  4. , , . TRP channels in skin biology and pathophysiology. Pharmaceuticals (Basel). 2016;9
    [CrossRef] [Google Scholar]
  5. , , , . Activation of TRPV1 channel by dietary capsaicin improves visceral fat remodeling through connexin43-mediated Ca2+ influx. Cardiovasc. Diabetol.. 2015;14:22.
    [CrossRef] [Google Scholar]
  6. , , , . The incidence of co-morbidities related to obesity and overweight: a systematic review and meta-analysis. BMC Public Health. 2009;9:88.
    [CrossRef] [Google Scholar]
  7. , , , . Inhibition of HDAC3 promotes ligand-independent PPARγ activation by protein acetylation. J. Mol. Endocrinol.. 2014;53:191-200.
    [CrossRef] [Google Scholar]
  8. , , , . Antioxidant and skin anti-aging effects of marigold methanol extract. Toxicol Res.. 2018;34:31-39.
    [CrossRef] [Google Scholar]
  9. , , . Genetic and developmental control of multiple forms of L-glycerol 3-phosphate dehydrogenase. J. Biol. Chem.. 1974;249:7775-7781.
    [Google Scholar]
  10. , , , . Isorhamnetin represses adipogenesis in 3T3-L1 cells. Obesity (Silver Spring). 2009;17:226-232.
    [CrossRef] [Google Scholar]
  11. , , , . The role of TRPV1 channel in aged human skin. J. Dermatol. Sci.. 2012;65:81-85.
    [CrossRef] [Google Scholar]
  12. , , , . Berberine Alleviates Olanzapine-Induced Adipogenesis via the AMPKα-SREBP Pathway in 3T3-L1 Cells. Int. J. Mol. Sci.. 2016;17
    [CrossRef] [Google Scholar]
  13. , , , . Irradiation of skin with visible light induces reactive oxygen species and matrix-degrading enzymes. J, Invest. Dermatol.. 2012;132:1901-1907.
    [CrossRef] [Google Scholar]
  14. , , , . Saikosaponin A and D Inhibit Adipogenesis via the AMPK and MAPK Signaling Pathways in 3T3-L1 Adipocytes. Int. J. Mol. Sci.. 2021;22
    [CrossRef] [Google Scholar]
  15. , , , . Pronuciferine and nuciferine inhibit lipogenesis in 3T3-L1 adipocytes by activating the AMPK signaling pathway. Life Sci.. 2015;136:120-125.
    [CrossRef] [Google Scholar]
  16. , , . The Prospective Antiobesity Effect of Capsaicin Synthetic Analogs: A Matter of Weight. Med. Chem.. 2016;06
    [CrossRef] [Google Scholar]
  17. , , , . A binding protein for fatty acids in cytosol of intestinal mucosa, liver, myocardium, and other tissues. Science. 1972;177:56-58.
    [CrossRef] [Google Scholar]
  18. , , , . 3,5-Dicaffeoyl-Epi-Quinic Acid Isolated from Edible Halophyte Atriplex gmelinii Inhibits Adipogenesis via AMPK/MAPK Pathway in 3T3-L1 Adipocytes. Evid. Based Complement. Alternat. Med.. 2018;2018:8572571.
    [CrossRef] [Google Scholar]
  19. , , , . Yellow Chaste weed and its components, Apigenin and Galangin, affect proliferation and oxidative stress in blue light-irradiated HaCaT cells. Nutrients. 2022;14
    [CrossRef] [Google Scholar]
  20. , , , . Whether all obese subjects both in metabolic groups and non-metabolic groups should be treated or not. J. Diabetes Metab. Disord.. 2014;13:21.
    [CrossRef] [Google Scholar]
  21. , , , . Development of a novel anti-obesity compound with inhibiting properties on the lipid accumulation in 3T3-L1 adipocytes, Iran. Biomed. J.. 2020;24:155-163.
    [CrossRef] [Google Scholar]
  22. , , , . PKA regulatory subunit R2B is required for murine and human adipocyte differentiation. Endocr. Connect.. 2013;2:196-207.
    [CrossRef] [Google Scholar]
  23. , . The medical risks of obesity. Postgrad. Med.. 2009;121:21-33.
    [CrossRef] [Google Scholar]
  24. , , , . A novel method for evaluating sun visible light protection factor and pigmentation protection factor of sunscreens. Clin. Cosmet. Investig. Dermatol.. 2019;12:605-616.
    [CrossRef] [Google Scholar]
  25. , , , . Expression of genes involved in adipogenesis and lipid metabolism in subcutaneous adipose tissue and longissimus muscle in low-marbled Pirenaica beef cattle. Animal. 2016;10:2018-2026.
    [CrossRef] [Google Scholar]
  26. , , , . TRPV1-mediated UCP2 upregulation ameliorates hyperglycemia-induced endothelial dysfunction. Cardiovasc. Diabetol.. 2013;12:69.
    [CrossRef] [Google Scholar]
  27. , , , . Mitotic clonal expansion: a synchronous process required for adipogenesis. PNAS. 2003;100:44-49.
    [CrossRef] [Google Scholar]
  28. , , . Structure and function of TRPV1. Pflugers Arch.. 2005;451:143-150.
    [CrossRef] [Google Scholar]
  29. , , , . Roflumilast Suppresses Adipogenic Differentiation via AMPK Mediated Pathway. Front. Endocrinol. (Lausanne).. 2021;12:662451
    [CrossRef] [Google Scholar]
  30. , , , . WSF-CT-11, a sesquiterpene derivative, activates AMP-Activated Protein Kinase with anti-diabetic effects in 3T3-L1 adipocytes. ACS Omega. 2021;6:31272-31281.
    [CrossRef] [Google Scholar]
  31. , , , . Blue Light Irradiation Induces Human Keratinocyte Cell Damage via Transient Receptor Potential Vanilloid 1 (TRPV1) Regulation. Oxid. Med. Cell. Longev.. 2020;2020:8871745.
    [CrossRef] [Google Scholar]
  32. , , , . KRAS affects adipogenic differentiation by regulating autophagy and MAPK activation in 3T3-L1 and C2C12 cells. Int. J. Mol. Sci.. 2021;22
    [CrossRef] [Google Scholar]
  33. , , , . Activation of transient receptor potential vanilloid type-1 channel prevents adipogenesis and obesity. Circ. Res.. 2007;100:1063-1070.
    [CrossRef] [Google Scholar]
  34. , , , . Glycerol-3-phosphate dehydrogenase (GPDH) gene family in Zea mays L.: identification, subcellular localization, and transcriptional responses to abiotic stresses. PLoS One. 2018;13:e0200357.
    [Google Scholar]
Show Sections