5.2
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
5.3
Impact Factor
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Corrigendum
Current Issue
Editorial
Erratum
Full Length Article
Full lenth article
Letter to Editor
Original Article
Research article
Retraction notice
Review
Review Article
SPECIAL ISSUE: ENVIRONMENTAL CHEMISTRY
View/Download PDF

Translate this page into:

03 2024
:17;
105590
doi:
10.1016/j.arabjc.2023.105590

Probiotics mitigated sepsis-related mortality through antioxidant and inflammatory-mediated mechanisms

Department of Emergency Medicine, Yancheng First People's Hospital, No. 66 Renmin South Road, Yancheng 224000, China
Department of Respiratory and Critical Care Medicine, Yancheng First People's Hospital, No. 66 Renmin South Road, Yancheng 224000, China

⁎Corresponding author. zholia@126.com (Liangliang Zhou)

Disclaimer:
This article was originally published by Elsevier and was migrated to Scientific Scholar after the change of Publisher.

Abstract

The current therapies used to treat sepsis are ineffective and sepsis-related mortality is high. Therefore, it is important to find new treatment options that reduce mortality from that disease. In the present study, the effects of probiotic pretreatment in septic rats were studied on morality, hematological parameters, oxidative stress, antioxidant capacity, and inflammation. After preparation of rats and administration of probiotic VSL # 3, cecal ligation and puncture (CLP) surgery was used to induce sepsis. Then, the animals were divided into four groups: sham, sham + VSL # 3, septic, and septic + VSL # 3. Sepsis-related mortality, hematological parameters, and biochemical factors were assessed. Also, the expression of inflammatory cytokines IL-6, TNF-α and IL-10 in serum were studied using enzyme-linked immunosorbent assay (ELISA). Then, the NF-κB gene and protein expression in intestinal tissue was studied by RT-qPCR and western blot techniques, respectively. Daily pretreatment with VSL # 3 in septic rats resulted in a 20 % reduction in mortality over 10 days and a significant modulation in hematological parameters. Evaluation of oxidant and antioxidant indices showed a decrease in oxidative stress and an increase in antioxidant capacity in septic rats receiving VSL # 3. Also, decreased expressions of inflammatory cytokines IL-6, TNF-α, IL-10, and NF-κB were observed in septic rats receiving VSL # 3. In general, it can be concluded that the administration of probiotic VSL # 3, which resulted in the improved survival of septic rats and better antioxidant and anti-inflammatory conditions, can be considered as a new adjutant therapeutic approach in the treatment of sepsis.

Keywords

Sepsis
Cytokine
Antioxidant
Rat
Probiotics
1

1 Introduction

Sepsis is a major cause of high mortality in the intensive care unit (ICU) and despite technical ICU advances and protective therapies, the prevalence of the disease is high, increasing by 1.5 to 8 % each year and imposing a high economic burden on the health system (Hotchkiss and Karl, 2003). Mortality rates associated with sepsis and septic shock are estimated at 25–30 % and 40–70 %, respectively (Russell, 2006).

Sepsis is a systemic inflammatory response syndrome (SIRS) that occurs due to the acute response of the immune system to microorganisms or their toxins in the bloodstream (Kumar and Sharma, 2010). This response is initiated by immune cells such as neutrophils, monocytes, and macrophages (Charavaryamath, Janardhan et al., 2006). Irregularity in this response leads to the release of large amounts of proinflammatory cytokines, leading to vital organ dysfunction and death (Adib-Conquy and Cavaillon, 2007). Also, overproduction of reactive oxygen species (ROS) and reduction of the antioxidant defense system play an important role in the pathology of sepsis (Xie, Yu et al., 2010).

Despite the widespread use of antibiotics and their synthetic analogues in treatment of sepsis (Klompas, Calandra et al., 2018), it is still necessary to find new effective drug agents, as antibiotics are associated with many undesirable side effects (De Waele and Dhaese, 2019) and in recent years, the resistance of pathogens to antibiotics has been increasing and has caused major concerns in the health system (Rhee, Kadri et al., 2020). The development of immunomodulatory therapies is one of the important strategies for the treatment of sepsis (Hutchins, Unsinger et al., 2014). Recently, some natural products with the few side effects including thymoquinone (Alkharfy, Ahmad et al., 2022), Rhododendron arboreum Polysaccharides (Ahmad, Wali et al., 2020) and zingerone (Wali, Rehman et al., 2020) showed protective effects against sepsis models of animals. However, one of the promising therapeutic approaches in sepsis is the use of probiotics (Nair and Soraisham, 2013) and its therapeutic effects in patients admitted to ICU in the prevention of severe infections and septic shock have been reported in various studies (Pitsouni, Alexiou et al., 2009, Morrow, Kollef et al., 2010). A commercially available probiotic supplement is VSL#3, which consists of eight strains of probiotic bacteria. Studies have shown that this supplement has protective effects on intestinal barrier function (Mastrangeli, Corinti et al., 2009), gastric ulcer (Dharmani, De Simone et al., 2013), uncomplicated diverticulitis (Tursi, Brandimarte et al., 2007) and familial adenomatous polyposis (Friederich, Verschuur et al., 2011). However, the exact mechanism of its beneficial effects in the treatment of sepsis is not yet fully understood and further studies are needed.

Cecal ligation and puncture (CLP) is one of the most widely used sepsis models for inducing an immune response by microbial infection, which has been used both in clinical conditions and on laboratory animals such as mice, and it has been stated that it produces cytokine expression levels similar to sepsis in humans (Toscano, Ganea et al., 2011). It has been stated that the length of cecal ligation in the main important factor determining the success or failure of this model in simulating sepsis (Ruiz, Vardon-Bounes et al., 2016). Importantly, this model is approved as the golden standard in sepsis research (Ruiz, Vardon-Bounes et al., 2016).

Therefore, in the present study, the effects of the use of VSL#3 probiotics on the laboratory model of septic mice were studied and the antioxidant and anti-inflammatory response as well as the mortality rate of septic animals were investigated. Also, the intestinal microbial flora in response to this therapeutic approach was studied.

2

2 Materials and methods

2.1

2.1 Animals and sepsis induction

In the current study, 40 adult Wistar male rats (190–200 g) were used. Applications to animals were made in accordance with universal ethical principles and with the approval of the local ethics committee, Yancheng First People's Hospital, Yancheng, China. The rats were adapted to laboratory conditions (pathogen-free) for one week and then underwent probiotic treatments for one week. The animals had free access to food and water, and to avoid the circadian cycle, all experiments were performed at 9 a.m. till 15 p.m. Animals were divided into four groups: Sham (n = 5), Sham + VSL # 3 (n = 5), Septic (n = 5) and Septic + VSL # 3 (n = 5).

Animals received commercial probiotic compound VSL # 3 (VSL, USA) daily for one week at a concentration of 2.8 × 108 CFU in 30 µl (Ewaschuk, Endersby et al., 2007). Septic induction was performed after day 7.

CLP surgery was used to induce septic in animals. In summary, after anesthetizing the rats with a combination of ketamine and xylazine, a 2 cm incision was made in their abdominal wall. The cecum was then removed and the stool inside the cecum was transferred to the end with finger pressure. The cecum was sutured below the ileocecal valve with a 3–0 suture, and the cecum (without damage to blood vessels) was punctured 2 times by a G20 needle. Then, the skin and peritoneum were sutured by returning the intestine into the abdominal chamber (Hubbard, Choudhry et al., 2005). In sham rats, the cecum was neither ligated nor punctured. 24 h after CLP surgery, the animals were anesthetized by ketamine and xylazine (5 ml ketamine and 3 ml xylazine) and blood samples were taken for biochemical evaluations.

2.2

2.2 Survival rate

To study the effect of probiotics on septic rat survival, the rats were administered probiotics for 10 days after CLP, and rat mortality was recorded daily and finally expressed as a percentage.

2.3

2.3 Hematological parameters

At the end day of experiment, the blood sample was taken from animals and collected in tubes containing EDTA and plasma samples were transferred to the hematological lab for measuring hematological parameter including BUN, ALT, AST, ALP, bilirubin, albumin and creatinine.

2.4

2.4 Biochemical analysis

2.4.1

2.4.1 Reactive oxygen species

Reactive Oxygen Species (ROS) Fluorometric Assay Kit (CAT# MBS2540517, Mybiosource, USA) was used to measure ROS level in plasma-based manufacture instructions.

2.4.2

2.4.2 Lipid peroxidation

Thiobarbitoric acid reactive substances (TBARS) were used as an indicator for measuring lipid peroxidation using thiobarbituric acid reagent (TBA) and its adsorption against blank at 535 nm by spectrophotometer.

2.4.3

2.4.3 Measurement of total plasma antioxidant capacity

Ferric reducing antioxidant power (FRAP) method was used to measure the total antioxidant capacity of plasma (Benzie and Strain, 1996). For this purpose, different concentrations were prepared from standard Fe2 + iron solution. Then FRAP working solution (RPTZ solution and standard FeCl3 solution) was added to plasma as well as standard solutions and after 10 min of incubation at 37° C, the light absorption of all samples was read by a spectrophotometer at 593 nm and the FRAP rate was based on the standard curve. Calculated.

2.4.4

2.4.4 Measurement of reduced glutathione (GSH)

Reduced glutathione was measured using a Reduced Glutathione (GSH) Assay Kit (CAT # MAK364-1KT, Sigma, USA) and absorbance readings at 450 nm by a spectrophotometer.

2.4.5

2.4.5 Catalase and super oxide dismutase

Serum superoxide dismutase (SOD) activity was measured by Kakar method (Kakkar, Das et al., 1984). The basis of this method is inhibition of the formation of tetrazolium formazan blue dye by superoxide dismutase in the reaction mixture containing phenazine methosulfate-reduced nicotinamide adenine dinucleotide-nitroblutotrazolium NADH (Phenazine Methosulphate-NBT). The reaction was started by adding 0.2 ml of NADH solution at a concentration of 750 μM at 30° C. After 90 s, the reaction was stopped by adding 0.1 ml of glacial acetic acid and 4 ml of butanol was added to the reaction mixture and vortexed well. The mixture was centrifuged for 5 min at 4000 rpm and the supernatant light absorption was measured at 560 nm against butanol. Activity was expressed in U/mL.

Serum catalase activity was measured by the Aebi method (Aebi, 1984). This method is based on the decomposition of hydrogen peroxide by catalase. The reaction was started by adding 0.5 ml of 50 mM H2O2 to the mixture. Reduction of adsorption due to decomposition of hydrogen peroxide at 240 nm was measured at intervals of 1, 2 and 3 min and according to the average adsorption per minute, catalase activity was expressed in mU/L.

2.4.6

2.4.6 Proinflammatory cytokines

The expressions of proinflammatory cytokines interleukin 10 (IL-10) (ab185986), abcam, USA), tumor necrosis factor α (TNF-α) (ab46070, abcam, USA), interleukin 6 (IL-6) (ab100772, abcam, USA) and nuclear factor–ĸB (NF-κB-p65) protein (MBS2505513, Mybiosource, USA) were studied using the enzyme-linked immunosorbent assay (ELISA) technique. The manufacturer's instructions were used to measure these cytokines and expressed in pg/mL.

2.5

2.5 Quantitative real-time PCR (RT-qPCR) analysis

The total RNA was extracted from intestinal tissue by Trizol (Invitrogen, USA) according to the manufacturer’s instructions and after qualification and quantification by gel electrophoresis and optical density ratio at 260/280, total RNA was reverse-transcribed into cDNA using the TaqMan kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. PCR amplification was done by specific primers (Table 1).

Table 1 The sequences of the primers (Abdelnaser, Alaaeldin et al., 2023).
Genes Empty Cell Primer sequence
NF-κB Forward 5′- TTACGGGAGATGTGAAGATG -3′
Reverse 5′- ATGATGGCTAAGTGTAGGAC -3′
GAPDH Forward 5′- ACCAACTGCTTAGCCCCCC -3′
Reverse 5′- GCATGTCAGATCCACAACGG -3′

mRNA expression levels were assessed using Power SYBR Green (Takara, Dalian China) on an ABI 7500. The 2-ΔΔCt method was used to normalize target gene transcription to GAPDH expression as internal control.

2.6

2.6 Western blot analysis

After harvesting the proteins from intestinal tissue and separating by 10 % SDS-polyacrylamide gel electrophoresis (SDS-PAGE), they were transferred onto a nitrocellulose membrane and blocked with 5 % non-fat milk. Then, the blots were incubated with primary antibodies [(p-NF-κB/p65; 1:1000; Cell Signaling Technologies; Beverly, MA, USA) and GAPDH (dilution, Cell Signaling Technologies; Beverly, MA, USA)] at 4 °C overnight. Afterward, the samples were washed with TBST and then incubated with an HRP-conjugated goat anti-rabbit secondary antibody at room temperature for 1 h. Immunoblots were visualized using the ECL detection system.

2.7

2.7 Statistical analysis

In order to perform statistical tests, first the normality of the data was checked using Kolmogorov-Smirnov. After ensuring the normal distribution of the data, analysis was done using one-way ANOVA and Scheffe post hoc test at P < 0.05 probability level. GraphPad Prism V.8 software was used for data analysis.

3

3 Results

3.1

3.1 Survival rate

VSL # 3 probiotic increased the survival rate of septic rats during 10 days (Fig. 1). Although all sepsis rats died by day 6, the sepsis group receiving VSL # 3 showed a 20 % survival rate by day 10, indicating the positive effects of VSL # 3 probiotic on improving survival rate in sepsis.

The effects of VSL#3 administration on survival rate of septic rats. The rats were daily gavaged by VSL#3 probiotics 1 week before CLP and continued for 10 days after. VSL#3 administration reduced CLP-related morality during 10 days. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).
Fig. 1
The effects of VSL#3 administration on survival rate of septic rats. The rats were daily gavaged by VSL#3 probiotics 1 week before CLP and continued for 10 days after. VSL#3 administration reduced CLP-related morality during 10 days. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).

3.2

3.2 Hematological parameters

The plasma levels of BUN (Fig. 2a), ALT (Fig. 2b), AST (Fig. 2c), ALP (Fig. 2d), and bilirubin (Fig. 2e) elevated, while albumin level (Fig. 2f) decreased in the rats after CLP surgery, indicating possible both liver and kidney injury (P < 0.0001). However, the treatment of septic rats with the VSL#3 probiotics prevented partially the increases in BUN, ALT, AST, ALP and bilirubin and decrease in albumin of the plasma. There were also significant differences in the plasma levels of aforementioned hematological parameters in the septic rats received VSL#3 probiotics compared with healthy ones.

The effects of VSL#3 administration on the plasma levels of BUN (a), ALT (b), AST (c), ALP (d), bilirubin (e). and albumin (f) of septic rats (n = 5). The rats were daily gavaged by VSL#3 probiotics 1 week before CLP and continued for 10 days after.
Fig. 2
The effects of VSL#3 administration on the plasma levels of BUN (a), ALT (b), AST (c), ALP (d), bilirubin (e). and albumin (f) of septic rats (n = 5). The rats were daily gavaged by VSL#3 probiotics 1 week before CLP and continued for 10 days after.

3.3

3.3 Oxidative stress and antioxidant capacity

CLP-induced sepsis resulted in increased ROS content (Fig. 3a), lipid peroxidation (Fig. 3b), and decreased plasma antioxidant capacity (Fig. 3c). However, VSL # 3 pretreatment decreased ROS production and lipid peroxidation and increased antioxidant capacity in septic rats, indicating a decrease in CLP-induced oxidative stress with VSL # 3 pretreatment. VSL # 3 appears to significantly reduce CLP-induced oxidative stress by improving its antioxidant status.

Effects of pretreatment of VSL#3 on ROS (a), Malone aldehyde (MDA) (b) and ferric reducing antioxidant power (FRAP) (c) in CLP-induced sepsis in rats. VSL#3 administration was done 1 week before CLP and after 24 h the serum was prepared and evaluated. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).
Fig. 3
Effects of pretreatment of VSL#3 on ROS (a), Malone aldehyde (MDA) (b) and ferric reducing antioxidant power (FRAP) (c) in CLP-induced sepsis in rats. VSL#3 administration was done 1 week before CLP and after 24 h the serum was prepared and evaluated. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).

CLP surgery significantly reduced GSH content, CAT and SOD enzyme activities, indicating a decrease in cell antioxidant capacity in sepsis. However, VSL # 3 pretreatment before CLP prevented a decrease in these antioxidant markers, and there were significant differences in GSH content (Fig. 4a), SOD (Fig. 4b), and CAT (Fig. 4c) activities in VSL#3-pretreated CLP rats in comparison with septic untreated rats.

Serum levels of GSH (a), SOD (b) and CAT (c) activities in CLP-induced sepsis rats pretreated with VSL#3 probiotics. VSL#3 administration was done 1 week before CLP and after 24 h the serum was prepared and evaluated. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).
Fig. 4
Serum levels of GSH (a), SOD (b) and CAT (c) activities in CLP-induced sepsis rats pretreated with VSL#3 probiotics. VSL#3 administration was done 1 week before CLP and after 24 h the serum was prepared and evaluated. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).

3.4

3.4 Inflammation response

An increase in the expressions of inflammatory cytokines IL-10 (Fig. 5a), IL-6 (Fig. 5b) and TNF-α (Fig. 5c) were observed in CLP rats, indicating an intensification of inflammatory responses in sepsis conditions. However, VSL # 3 pretreatment in CLP rats prevented increased expression of these proinflammatory cytokines. VSL # 3 appears to have anti-inflammatory effects in sepsis by inhibiting the expressions of these cytokines.

The effects of VSL#3 pretreatment on the expressions of IL-10 (a), IL-6 (b) and TNF-α (c) cytokines in rats subjected to CLP surgery. VSL#3 administration was done 1 week before CLP and after 24 h the serum was prepared and evaluated. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).
Fig. 5
The effects of VSL#3 pretreatment on the expressions of IL-10 (a), IL-6 (b) and TNF-α (c) cytokines in rats subjected to CLP surgery. VSL#3 administration was done 1 week before CLP and after 24 h the serum was prepared and evaluated. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).

3.5

3.5 NF-κB

In this study, the expression levels of NF-κB in serum (Fig. 6a), NF-κB-p65 gene (Fig. 6b) and NF-κB-p65 protein (Fig. 6c) in the intestinal tissue were studied. The results showed upregulation of NF-κB-p65 protein in both serum and intestinal tissue in CLP rats. Furthermore, NF-κB-p65 gene overexpressed in the intestinal tissue of septic rats, indicating the onset of inflammatory responses. However, in CLP rats receiving VSL # 3, a decrease in NF-κB gene and protein expressions were observed in both serum and intestinal tissue compared to the septic group, indicating a strong anti-inflammatory effect of VSL # 3 in sepsis.

The effects of VSL#3 pretreatment on the expression of NF-κB protein in serum (a) and NF-κB gene (b) and protein (c) in the intestinal tissue. VSL#3 administration was done 1 week before CLP and after 24 h the tissue or serum was prepared and evaluated. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).
Fig. 6
The effects of VSL#3 pretreatment on the expression of NF-κB protein in serum (a) and NF-κB gene (b) and protein (c) in the intestinal tissue. VSL#3 administration was done 1 week before CLP and after 24 h the tissue or serum was prepared and evaluated. Sham (n = 5), sham + VSL#3 (n = 5), Septic (n = 5), Septic + VSL#3 (n = 5).

4

4 Discussion

The results of the current study indicate the positive effects of VSL # 3 probiotics in reducing sepsis-induced mortality. Biochemical studies have shown that its positive effects can be due to reducing oxidative stress, increasing antioxidant capacities and anti-inflammatory properties.

Sepsis is one of the most common conditions in traumatic injury, the acute and early onset of which causes long-term complications such as immunosuppression and respiratory problems, and ultimately leads to death (Benjamim, Hogaboam et al., 2004). In the present study, induction of sepsis in rats was performed by CLP surgical method, which was a cost-effective and rapid method. In general, in this model, intestinal microorganisms enter the bloodstream and cause sepsis (Hubbard, Choudhry et al., 2005). In sepsis, the increase in microbial load through the activation of pathways involved in oxidative stress leads to the induction of oxidative stress, which ultimately causes damage to vital organs of the body (Guo and Ward, 2007, Angus and Van der Poll, 2013). In the present study, the first observation of oxidative damage was an increase in ROS and MDA content in rats. The increase in MDA, which indicates lipid peroxidation, was accompanied by a significant decrease in GSH concentration 24 h after induction of sepsis. Also, the level of FRAP, which is an indicator of total antioxidant measurement (Andresen, Regueira et al., 2008, Gajardo, von Dessauer et al., 2018), decreased significantly in the sepsis group, indicating a disturbance in the balance of oxidative stress and antioxidants caused by sepsis. These results indicate the induction of severe oxidative stress in sepsis, which is consistent with the results of other studies.

The use of current therapeutic approaches in the treatment of sepsis alters the gut microbiota and reduces the population of beneficial bacteria and provides the conditions for the pathogen to overgrow and multiply (Wang, Andersson et al., 1996, Alverdy and Chang, 2008). Therefore, probiotics can be considered as a treatment option for sepsis, and our study showed that probiotic pretreatment can prevent sepsis-related mortality. This can be attributed to the increase in the population of beneficial bacteria and thus the decrease in the population of pathogens and the increase in intestinal barrier function (Doig, Sutherland et al., 1998, Alverdy and Chang, 2008). Therefore, by preventing pathogenic pathogens from entering the bloodstream, it has prevented oxidative damage. It can be stated that probiotics have reduced CLP-induced oxidative stress by improving antioxidant capacity and reducing CLP-induced mortality.

Elevated cytokines such as TNF-α, IL-6 and IL-10 in sepsis conditions and their role in organ failure have been well described (Sikora, Chlebna-Sokol et al., 2001, Cao, Tu et al., 2012). These cytokines have been reported to be predictors of clinical outcomes (Simpson, Smith et al., 2000, Rayes, Seehofer et al., 2005, Dhar, K et al., 2021). In the present study, upregulation of inflammatory cytokines TNF-α, IL-6 and IL-10 were observed in septic rats, which is consistent with the above results (Gogos, Drosou et al., 2000, Cao, Tu et al., 2012). Their role in intestinal barrier dysfunction has also been reported (Fink, 2003). Studies have reported that probiotics inhibit the production of proinflammatory cytokines (Matsumoto, Hara et al., 2005, Lin, Thibodeaux et al., 2008, Hegazy and El-Bedewy, 2010, Mykhal'chyshyn, Bodnar et al., 2013). In the present study, it was found that administration of probiotic VSL # 3 prevents the increase of expression in inflammatory cytokines induced by CLP, which confirms the anti-inflammatory effects of this compound.

In the present study, downregulation of NF-κB protein expression was observed as a result of probiotic VSL # 3 pretreatment in septic rats. The role of probiotics in inhibiting NF-κB has been shown in various studies (Dai, Zheng et al., 2013, Bhardwaj, Singh et al., 2020) and it has been stated that this inhibitory effect is via Peroxisome proliferator-activated receptor γ (PPARγ) (Gionchetti, Lammers et al., 2005). PPARγ has inhibitory effects on NF-κB activity (Genolet, Wahli et al., 2004) and this can have protective effects in sepsis conditions and prevent vital organ dysfunction (Zingarelli, Sheehan et al., 2003, Collin, Abdelrahman et al., 2004). Therefore, the protective effects of probiotic VSL # 3 on sepsis and reduced mortality in the present study can be attributed to inhibition of NF-κB protein expression and prevention of inflammation and organ dysfunction.

This study showed protective effects of probiotics in reducing sepsis intensity and improving the survival of rat model. However, as the results of in vivo findings must be confirmed in the clinical settings, therefore we strongly recommend the clinical studies evaluating the probiotics effects in septic patients.

5

5 Conclusion

In general, it can be concluded that probiotic VSL # 3 has protective effects against sepsis and can be considered as an adjuvant therapy. Its protective effects can be attributed to the reduction of ROS, improving the antioxidant status of cell by increasing the activities of SOD and CAT enzymes as well as GSH content. It also reduced the anti-inflammatory cytokine in the septic rats. However, we recommend the inclusion of antibiotic group for future in vivo studies. Also, the clinical trials in this area are recommended.

Funding

This study was supported by the Yancheng Basic Research Program (NO.YCBK202211).

Acknowledgement

The authors would like to appreciate Liya Zheng for help in preparing this paper.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. , , , , . Hepatoprotective potential of gabapentin in cecal ligation and puncture-induced sepsis; targeting oxidative stress, apoptosis, and NF-kB/MAPK signaling pathways. Life Sci.. 2023;320:121562
    [Google Scholar]
  2. , , . Stress molecules in sepsis and systemic inflammatory response syndrome. FEBS Lett.. 2007;581(19):3723-3733.
    [Google Scholar]
  3. , . [13] Catalase in vitro. Methods Enzymol., Academic Press.. 1984;105:121-126.
    [Google Scholar]
  4. , , , , , , , , . Therapeutic Potential of Rhododendron arboreum Polysaccharides in an Animal Model of Lipopolysaccharide-Inflicted Oxidative Stress and Systemic Inflammation. Molecules. 2020;25(24)
    [Google Scholar]
  5. , , , , , . Thymoquinone modulates the expression of sepsis-related microRNAs in a CLP model. Exp Ther Med. 2022;23(6):395.
    [Google Scholar]
  6. , , . The re-emerging role of the intestinal microflora in critical illness and inflammation: why the gut hypothesis of sepsis syndrome will not go away. J. Leukoc. Biol.. 2008;83(3):461-466.
    [Google Scholar]
  7. , , , , , , , , . Lipoperoxidation and Protein Oxidative Damage Exhibit Different Kinetics During Septic Shock. Mediators Inflamm.. 2008;2008:168652
    [Google Scholar]
  8. , , . Severe sepsis and septic shock. N Engl J Med. 2013;369:840-851.
    [Google Scholar]
  9. , , , . The chronic consequences of severe sepsis. J. Leukoc. Biol.. 2004;75(3):408-412.
    [Google Scholar]
  10. , , . The Ferric Reducing Ability of Plasma (FRAP) as a Measure of “Antioxidant Power”: The FRAP Assay. Anal. Biochem.. 1996;239(1):70-76.
    [Google Scholar]
  11. , , , , , , , , , . Probiotic mediated NF-κB regulation for prospective management of type 2 diabetes. Mol. Biol. Rep.. 2020;47(3):2301-2313.
    [Google Scholar]
  12. , , , , , , . Protective effect of Ulinastatin against murine models of sepsis: Inhibition of TNF-α and IL-6 and augmentation of IL-10 and IL-13. Exp. Toxicol. Pathol.. 2012;64(6):543-547.
    [Google Scholar]
  13. , , , , . Pulmonary intravascular monocytes/macrophages in a rat model of sepsis. Anat. Rec. A Discov. Mol. Cell. Evol. Biol.. 2006;288A(12):1259-1271.
    [Google Scholar]
  14. , , , . Endogenous ligands of PPAR-γ reduce the liver injury in haemorrhagic shock. Eur. J. Pharmacol.. 2004;486(2):233-235.
    [Google Scholar]
  15. , , , , , , . VSL#3 probiotics exerts the anti-inflammatory activity via PI3k/Akt and NF-κB pathway in rat model of DSS-induced colitis. Mol. Cell. Biochem.. 2013;374(1):1-11.
    [Google Scholar]
  16. , , . Antibiotic stewardship in sepsis management: toward a balanced use of antibiotics for the severely ill patient. Expert Rev. Anti Infect. Ther.. 2019;17(2):89-97.
    [Google Scholar]
  17. Dhar, S. K., V. K, S. Damodar, S. Gujar and M. Das (2021). “IL-6 and IL-10 as predictors of disease severity in COVID-19 patients: results from meta-analysis and regression.” Heliyon 7(2): e06155.
  18. , , , . The probiotic mixture VSL# 3 accelerates gastric ulcer healing by stimulating vascular endothelial growth factor. PLoS One. 2013;8(3):e58671.
    [Google Scholar]
  19. , , , , , , . Increased intestinal permeability is associated with the development of multiple organ dysfunction syndrome in critically ill ICU patients. Am. J. Respir. Crit. Care Med.. 1998;158(2):444-451.
    [Google Scholar]
  20. , , , , , , , , . Probiotic bacteria prevent hepatic damage and maintain colonic barrier function in a mouse model of sepsis. Hepatology. 2007;46(3):841-850.
    [Google Scholar]
  21. , . Intestinal epithelial hyperpermeability: update on the pathogenesis of gut mucosal barrier dysfunction in critical illness. Curr. Opin. Crit. Care. 2003;9(2):143-151.
    [Google Scholar]
  22. , , , , , , , , , , . Effects of intervention with sulindac and inulin/VSL#3 on mucosal and luminal factors in the pouch of patients with familial adenomatous polyposis. Int. J. Colorectal Dis.. 2011;26(5):575-582.
    [Google Scholar]
  23. , , , , , , . Plasma Antioxidant Potential at Admission is Associated with Length of ICU Stay in Child with Sepsis: A Pilot Study. Fetal Pediatr. Pathol.. 2018;37(5):348-358.
    [Google Scholar]
  24. , , , . PPARs as Drug Targets to Modulate Inflammatory Responses? Current Drug Targets - Inflammation & Allergy. 2004;3(4):361-375.
    [Google Scholar]
  25. , , , , . VSL# 3: an analysis of basic and clinical contributions in probiotic therapeutics. Gastroenterol. Clin.. 2005;34(3):499-513.
    [Google Scholar]
  26. , , , , . Pro- versus Anti-inflammatory Cytokine Profile in Patients with Severe Sepsis: A Marker for Prognosis and Future Therapeutic Options. J. Infect. Dis.. 2000;181(1):176-180.
    [Google Scholar]
  27. , , . Role of oxidants in lung injury during sepsis. Antioxid. Redox Signal.. 2007;9(11):1991-2002.
    [Google Scholar]
  28. , , . Effect of probiotics on pro-inflammatory cytokines and NF-κB activation in ulcerative colitis. World J. Gastroenterol.: WJG. 2010;16(33):4145.
    [Google Scholar]
  29. , , . The pathophysiology and treatment of sepsis. N. Engl. J. Med.. 2003;348(2):138-150.
    [Google Scholar]
  30. , , , , , , , . Cecal ligation and puncture. Shock. 2005;24:52-57.
    [Google Scholar]
  31. , , , , , , , . Cecal ligation and puncture. Shock. 2005;24
    [Google Scholar]
  32. , , , , . The new normal: immunomodulatory agents against sepsis immune suppression. Trends Mol. Med.. 2014;20(4):224-233.
    [Google Scholar]
  33. Kakkar, P., Das, B., Viswanathan, P., 1984. “A modified spectrophotometric assay of superoxide dismutase”.
  34. , , , . Antibiotics for Sepsis—Finding the Equilibrium. JAMA. 2018;320(14):1433-1434.
    [Google Scholar]
  35. , , . Is neuroimmunomodulation a future therapeutic approach for sepsis? Int. Immunopharmacol.. 2010;10(1):9-17.
    [Google Scholar]
  36. , , , , , . Probiotic Lactobacillus reuteri suppress proinflammatory cytokines via c-Jun. Inflamm. Bowel Dis.. 2008;14(8):1068-1083.
    [Google Scholar]
  37. , , , , , , , , . Effects of Live and Inactivated VSL#3 Probiotic Preparations in the Modulation of in vitro and in vivo Allergen-Induced Th2 Responses. Int. Arch. Allergy Immunol.. 2009;150(2):133-143.
    [Google Scholar]
  38. , , , , , , , , . Probiotic Lactobacillus-induced improvement in murine chronic inflammatory bowel disease is associated with the down-regulation of pro-inflammatory cytokines in lamina propria mononuclear cells. Clin. Exp. Immunol.. 2005;140(3):417-426.
    [Google Scholar]
  39. , , , . Probiotic prophylaxis of ventilator-associated pneumonia: a blinded, randomized, controlled trial. Am. J. Respir. Crit. Care Med.. 2010;182(8):1058-1064.
    [Google Scholar]
  40. , , , . Effect of probiotics on proinflammatory cytokines level in patients with type 2 diabetes and nonalcoholic fatty liver disease. Likars'ka sprava. 2013;2:56-62.
    [Google Scholar]
  41. , , . Probiotics and Prebiotics: Role in Prevention of Nosocomial Sepsis in Preterm Infants. Int. J. Pediatr.. 2013;2013:874726
    [Google Scholar]
  42. , , , , , . Does the use of probiotics/synbiotics prevent postoperative infections in patients undergoing abdominal surgery? A meta-analysis of randomized controlled trials. Eur. J. Clin. Pharmacol.. 2009;65(6):561-570.
    [Google Scholar]
  43. , , , , , , , , . Supply of Pre- and Probiotics Reduces Bacterial Infection Rates After Liver Transplantation—A Randomized, Double-Blind Trial. Am. J. Transplant.. 2005;5(1):125-130.
    [Google Scholar]
  44. Rhee, C., Kadri, S. S., Dekker, J. P., Danner, R. L., Chen, H.-C., Fram, D., Zhang, F., Wang, R., Klompas, M., C. D. C. P. E. P. for the, 2020. “Prevalence of Antibiotic-Resistant Pathogens in Culture-Proven Sepsis and Outcomes Associated With Inadequate and Broad-Spectrum Empiric Antibiotic Use.” JAMA Network Open 3(4): e202899-e202899.
  45. , , , , , , , , . Sepsis modeling in mice: ligation length is a major severity factor in cecal ligation and puncture. Intensive Care Med. Exp.. 2016;4(1):22.
    [Google Scholar]
  46. , . Management of sepsis. N. Engl. J. Med.. 2006;355(16):1699-1713.
    [Google Scholar]
  47. , , , . Proinflammatory cytokines (IL-6, IL-8), cytokine inhibitors (IL-6sR, sTNFRII) and anti-inflammatory cytokines (IL-10, IL-13) in the pathogenesis of sepsis in newborns and infants. ARCHIVUM IMMUNOLOGIAE ET THERAPIAE EXPERIMENTALIS-ENGLISH EDITION-. 2001;49(5):399-404.
    [Google Scholar]
  48. , , , , , , , , , . Prognostic Value of Cytokine Concentrations (Tumor Necrosis Factor-α, Interleukin-6, and Interleukin-10) and Clinical Parameters in Severe Melioidosis. J. Infect. Dis.. 2000;181(2):621-625.
    [Google Scholar]
  49. , , , . Cecal ligation puncture procedure. J. Vis. Exp.. 2011;51
    [Google Scholar]
  50. , , , , , . Balsalazide and/or high-potency probiotic mixture (VSL#3) in maintaining remission after attack of acute, uncomplicated diverticulitis of the colon. Int. J. Colorectal Dis.. 2007;22(9):1103-1108.
    [Google Scholar]
  51. , , , , , , , , . Zingerone [4-(3-Methoxy-4-hydroxyphenyl)-butan-2] Attenuates Lipopolysaccharide-Induced Inflammation and Protects Rats from Sepsis Associated Multi Organ Damage. Molecules. 2020;25(21)
    [Google Scholar]
  52. , , , , , . Gut Origin Sepsis, Macrophage Function, and Oxygen Extraction Associated with Acute Pancreatitis in the Rat. World J. Surg.. 1996;20(3):299-308.
    [Google Scholar]
  53. , , , , , , , . Protective effects of hydrogen gas on murine polymicrobial sepsis via reducing oxidative stress and HMGB1 release. Shock. 2010;34(1):90-97.
    [Google Scholar]
  54. , , , , , , . Peroxisome proliferator activator receptor-γ ligands, 15-deoxy-Δ12, 14-prostaglandin J2 and ciglitazone, reduce systemic inflammation in polymicrobial sepsis by modulation of signal transduction pathways. J. Immunol.. 2003;171(12):6827-6837.
    [Google Scholar]
Show Sections