Translate this page into:
Quercetin attenuates cisplatin-induced ovarian toxicity in rats: Emphasis on anti-oxidant, anti-inflammatory and anti-apoptotic activities
⁎Address: Department of Biological Sciences, Faculty of Science, King Abdulaziz University, Jeddah, Saudi Arabia. malgandaby@kau.edu.sa (Mardi M. Algandaby) malgandaby@yahoo.com (Mardi M. Algandaby)
-
Received: ,
Accepted: ,
This article was originally published by Elsevier and was migrated to Scientific Scholar after the change of Publisher.
Abstract
Ovarian toxicity is a devastating adverse effect of cisplatin therapy. The objective of the current study was to address whether or not quercetin could protect against cisplatin-induced ovarian toxicity in rats as well as the possible underlying mechanisms. Rats were allocated into five groups. Group 1 represented the control, group 2 was administered quercetin (10 mg/kg), group 3 received cisplatin (6 mg/kg single i.p. dose) on days 7 and 14, the forth group was given cisplatin + quercetin (5 mg/kg) and the fifth group was administered cisplatin + quercetin (10 mg/kg). Quercetin ameliorated cisplatin-induced histopathological changes in ovarian tissues and significantly prevented the decline in the percentage of healthy follicles and serum anti-Mullerian hormone (AMH). Quercetin exhibited significant anti-oxidant effects evidenced by preventing MDA accumulation, glutathione depletion and superoxide and glutathione peroxidase exhaustion in the ovary. Also, quercetin displayed activities against cisplatin-induced inflammatory responses in the ovary. Quercetin significantly inhibited expression of NFκb, Cox-2 and IL-6 and elevated ovarian content of TNF-α. Further, quercetin showed anti-apoptotic activity as demonstrated by decreased caspase-3 content and modulation of Bax and Bcl2 expression in the ovary. Conclusively, quercetin protects against cisplatin-induced ovarian toxicity in rats. This is mediated, at least partly, by its anti-oxidant, anti-inflammatory and anti-apoptotic activities.
Keywords
Quercetin
Cisplatin
Ovary
Rats
1 Introduction
Cancer is still a worldwide health burden and a leading cause of death. In females, more than 912,000 new cancer cases and more than 285,000 estimated deaths were reported in the US in 2020 (Siegel et al., 2020). The use of chemotherapy is a standard approach for cancer treatment (Schirrmacher, 2019). However, ovarian toxicity induced by cancer chemotherapy is a foremost complication (Cho et al., 2020). Use of chemotherapy during reproductive age can cause ovarian insufficiency with dose and type-dependent loss of follicular reserve (Ashizawa and Kanda, 2020). Cisplatin is a chemotherapeutic agent used for cases of breast, lung, bladder, head and neck, testicular, esophageal, cervical and brain cancers (Ho et al., 2016). Chemically, it is cis-diamminedichloroplatinum (II), and has square planar platinum (II) complex and contains 2 ligands of chloride in a cis configuration orientation (Zhu et al., 2016). However, cisplatin therapy has been associated with innumerable adverse side effects including nephrotoxicity, ototoxicity, gastrointestinal toxicity, myelosuppression, and cardiotoxicity (Barabas et al., 2008). Further, cisplatin was reported to induce distinct ovarian follicle loss (Morgan et al., 2013). Numerous mechanisms have been proposed to explain cisplatin ovarian toxicity. These include induction of oxidative stress, inflammation and apoptosis (kaygusuzoglu et al., 2018).
Quercetin is a dietary flavonoid, and widely exists in many plants including onion, tomato, caper, black chokeberry, and lettuce (Bischoff, 2008). Quercetin has attracted increasing attention due to its pleotropic biological activities (Wang et al., 2016). These include antioxidant (Ghosh et al., 2015) and anti-inflammatory (Ozyel et al., 2021) activities. Pharmacologically, quercetin has been shown to possess cytotoxic (Zhang et al., 2012), neuroprotective (Moujahed et al., 2020), cardioprotective (Wang et al., 2021), hepatoprotective (Lin et al., 2020) and nephroprotective (Alidadi et al., 2018) actions. Additionally, its potential application in clinical medicine has been recently reviewed (Yang et al., 2020). Several reports have elucidated the effect of quercetin on ovarian functions in diverse in vivo models. Supplementation of food with quercetin caused obvious improvement of follicular development and diminished apoptosis of rabbits granulosa cells (Naseer et al., 2017). Further, quercetin ameliorated cadmium-induced toxicity in rat uterus and ovaries via its antioxidant and anti-apoptotic actions (Nna et al., 2017). In vitro studies indicated the ability of quercetin to protect against the toxicity and apoptotic death of ovarian granulosa cells (Capcarova et al., 2015). Additionally, quercetin has been reported to enhance the ovarian antioxidant capability during menopause in rats and in ovarian granulosa cells in vitro (Wang et al., 2018). Hence, the current study was intended to explore the potential of quercetin to protect against cisplatin-induced ovarian toxicity.
2 Materials and methods
2.1 Drugs and chemicals
Quercetin (purity: 98%) was obtained from Merck (St. Louis MO, USA). Cisplatin was obtained as Cisplatine® vials for injection (1 mg/1 mL, Mylan, Italy). Further chemicals were of the highest available grade.
2.2 Animals and study design
Thirty female Wistar rats (200–225 g) were obtained from our animal facility, King Abdulaziz University (KAU). Rats were housed on a 12-h light–dark cycle at 23 ± 2 °C. Animal hanling was approved Faculty of Pharmacy’s Research Ethics Committee, King Abdulaziz University (# PH-1442-63).
Rats were randomly divided into five groups (6 each) and treated for seventeen sequential days as follows: Group 1 (Control): animals were treated once daily with the vehicle (5% DMSO in corn oil; 5 mL/kg p.o.); Group 2 (Quercetin; Q): rats were treated once daily with the quercetin (dissolved in 5% DMSO in corn oil) at a dose of 10 mg/kg using the oral gave route; Group 3 (Cisplatin; CP): rats were treated once daily with the vehicle (5% DMSO in corn oil; 5 mL/kg p.o.). Besides, cisplatin group was administered a single intraperitoneal (i.p.) injection on days 7 and 14 with cisplatin (6 mg/kg).; Group 4 (CP + Q 5 mg/kg) and group 5 (CP + Q 10 mg/kg): rats were treated once daily with the quercetin (dissolved in 5% DMSO in corn oil) at a dose of 5 mg/kg or 10 mg/kg respectively. Furthermore, cisplatin group was given a single i.p. injection on days 7 and 14 with cisplatin (6 mg/kg). The doses of cisplatin and quercetin were chosen based on a pilot experiment and in accordance with previous studies (Qin et al., 2019; Said et al., 2019).
At 24 h after the last injection, rats were anesthetized by an i.p. injection of ketamine at a dose of 100 mg/kg and xylazine (10 mg/kg). Blood samples were collected from the retro-orbital sinus and allowed to coagulate. Sera were then separated by centrifugation at 3500 rpm for 15 min and stored at −80 °C for subsequent analyses. After blood collection, the rats were euthanized by decapitation. Then, abdomens were sterilized with povidone-iodine solution and opened longitudinally. Ovarian tissues were quickly dissected out, and washed with ice-cold PBS. Part of the ovaries were kept in 10% neutral-buffered formalin for subsequent histological and immunohistolochemical studies. The rest of the ovarian tissues were homogenized in PBS (0.1 M, pH 7.4), then centrifuged at 10,000 rpm at 4 °C for 15 min. Subsequently, supernatants were collected and stored at −80 °C.
2.3 Histopathological examination
Ovaries were kept in 10% formalin/saline for 24 h, then paraffin blocks were prepared by standard procedure. Then, they were sectioned (5 µm thickness). And stained using hematoxylin and eosin (H&E). Slides were examined and photographed using a light microscope (Nikon Eclipse TE2000-U, NIKON, Japan). Examinations were performed by a pathologist unaware of the treatment protocol. Follicles were distinguished as primordial, pre-antral, antral, and atretic as described previously (Britt et al., 2000; Said et al., 2019). Healthy follicles (%) was determined based on the following:
2.4 Biochemical analysis
Serum estradiol, anti-Müllerian hormone (AMH) and active caspase-3 were assessed using MyBiosource ELISA kits (Cat No. MBS263466, MBS9712690 and MBS7244630) (MyBiosource, San Diego, CA, USA) according to the manufacturer instructions. The ELISA analytical biochemical technique of the used kits is based on respective antibody-antigen interactions (immunosorbency) and a horseradish peroxidase (HRP) colorimetric detection system to detect the respective antigen targets in samples. Malondialdehyde (MDA) and reduced glutathione (GSH) contents, superoxide dismutase (SOD) and glutathione peroxidase (GPx) enzyme activities, and total protein were determined using commercially available kits (Biodiagnostic, Cairo, Egypt). Tumor necrosis factor-α (TNF-α) was estimated using rat ELISA kits (Cat. No. E-EL-R0019) obtained from Ellabscience, (Houston, TX, USA). The method depends on adding samples to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for rat TNF-α and Avidin-HRP conjugate were added successively to each micro plate well and incubated. The substrate was added to each well. Biotinylated antibody and avidin-HRP conjugate appeared blue in color. The optical density (OD) was measured spectrophotometrically at a wavelength of 450 nm and compared to a standard curve.
2.5 Immunohistochemical analyses
Following standard procedures for tissue preparations, slides were incubated overnight at 4 °C with the primary antibodies: rabbit polyclonal anti-NFκB (p65) (catalog # ab16502), anti-COX-2 (catalog # ab15191), and anti-IL-6 (catalog # ab271269) (ABCAM, Cambridge, UK). Slides were then flushed and incubated with the secondary anti-rabbit antibody (catalog # CTS005, R&D systems, MN, USA) (Kim et al., 2016). Images were analyzed as optical density (OP) using appropriate software (Image J, 1.46a, NIH, USA) using at least 3 sections per rat. Details of the protocol used in our laboratory have been previously described (Algandaby et al., 2017).
2.6 Real-time polymerase chain reaction (RT-qPCR) analysis of Bax and Bcl-2
Ovarian tissues were homogenized and RNA was extracted using a commercial kit and quantified. Reverse transcription was achieved using A cDNA Reverse Transcription Kit (catalog # 4368814, Applied Biosystems, Foster City, CA, USA). PCR was performed using Taq PCR Master Mix Kit (catalog # 201443, Qiagen, Valencia, CA, USA). Bax, and Bcl2 expression was determined in relation to β-actin. Sequence of forward and reverse primers of is illustrated in Table 1. After the RT-PCR run, the data were given in the cycle threshold (Ct). The relative quantitation (RQ) of each gene to β-actin was determined based on determining delta-delta Ct (ΔΔCt) (Livak and Schmittgen, 2001).
Forward
Reverse
Bax
CCTGAGCTGACCTTGGAGCA
GGTGGTTGCCCTTTTCTACT
Bcl2
TGATAACCGGGAGATCGTGA
AAAGCACATCCAATAAAAAGC
β-actin
TCCGTCGCCGGTCCACACCC
TCACCAACTGGGACGATATG
2.7 Statistical analysis
Data are presented as mean (M) ± SD. One-way ANOVA followed by Tukey’s test were used for comparing group means. Significance was taken at p < 0.05. GraphPad Prism version 8 (GraphPad, La Jolla, CA, USA) was used for statistical tests.
3 Results
3.1 Effect of quercetin against cisplatin-induced histological ovarian injury
Microscopic examination of ovarian tissue from the normal group (Fig. 1A) revealed normal histologic structure; the ovarian cortex contained different stages of developing follicles including primordial, primary, secondary and graafian follicles and the ovarian stroma was composed of collagenous fibers. In resemblance to the normal group, administration of quercetin (Fig. 1B) showed normal ovarian tissue. In cisplatin group (Fig. 1C), ovaries tissue showed numerous luteal structures occupying the ovarian cortex, intense inflammatory edema in the ovarian stroma with decreased numbers of developing follicles. This was evidenced by decreased proportion of primordial, pre-antral, and antral follicles and increased fraction of atretic follicles. However, daily administration of quercetin (5 mg/kg) exhibited an ameliorative action against cisplatin-induced ovarian toxicity, the normal developing follicles occupied most of the ovarian cortex with few luteal structures despite the intense inflammatory reaction observed in most of the examined cases (Fig. 1D). Co-administration of quercetin (10 mg/kg) achieved higher activities in protecting the ovarian tissue against cisplatin insult with lower inflammatory processes and higher proportion of healthy follicles (Fig. 1E). Semi-quantitative histological evaluation of follicles in the different groups indicated that cisplatin significantly impaired follicular maturation and resulted in almost 45% reduction of healthy follicles. However, quercetin (5 and 10 mg/kg) enhanced the proportion of healthy follicles by 40% and 61% in comparison to the cisplatin group (Fig. 1F).
Histopathological effects of quercetin on cisplatin-induced ovarian injury in rats. A: Control, showing different types of ovarian follicles; B: Control + Quercetin (Q), showing luteal structure (black arrow) and graafian follicle (black arrowhead); C: Cisplatin (CP), showing the luteal structures (blue stars) and the intense interstitial inflammatory reaction (red arrows); D: CP + Q (5 mg/kg), showing different stages of developing follicles, with scattered inflammatory cells infiltration; Hematoxylin &Eosin (H&E). E: CP + Q (10 mg/kg), showing normal graafian follicle with mild inflammatory cells infiltration; F: Semi-quantitative evaluation of % healthy follicles. Data are presented as Mean ± SD (n = 6). a Significant difference from Control group at p < 0.05. b Significant difference from CP at p < 0.05. c Significant difference from CP + Q (5 mg/kg) at p < 0.05.
3.2 Effect of quercetin on cisplatin-induced hormonal alterations
Serum estradiol levels were not significantly altered in the different study groups (Fig. 2A). To assess the impact of cisplatin on the number of follicular pool in the ovaries, serum levels of AMH was determined. Cisplatin significantly lowered AMH values by 45% compared to control group. However, treatment with quercetin significantly ameliorated the decline of AMH levels by 36% and 81% compared to the cisplatin group.
Effects of quercetin on serum levels of AMH (A) and estradiol (B) in cisplatin-treated rats. Data are presented as Mean ± SD (n = 6). a Significant difference from Control group at p < 0.05. b Significant difference from CP at p < 0.05. c Significant difference from CP + Q (5 mg/kg) at p < 0.05.
3.3 Effect of quercetin on oxidative status
The data in Table 2 indicate that ovaries from animals in the cisplatin group showed enhanced MDA content by 68%, depletion of GSH by 38% and exhaustion of SOD and GPx activities by 43% and 36%, respectively as compared to control values. Ovarian tissues collected from animals treated with quercetin (5 mg/kg) showed inhibition of MDA accumulation by 25% and enhancement of GSH content by 63% as well as elevation of SOD and GPX activities by 38 and 40% when compared to cisplatin group. Quercetin in the higher dose (10 mg/kg) almost normalized GSH content and SOD and GPx activities. Data are presented as Mean ± SD (n = 6). Statistical analysis was performed by one-way ANOVA followed by Tukey test.
MDA (nmol/mg protein)
GSH (nmol/mg protein)
SOD (Unit/mg protein)
GPx (Unit/mg protein)
Control
2.61 ± 0.28
2.37 ± 0.38
6.22 ± 0.74
44.52 ± 4.88
Quercetin (Q)
2.68 ± 0.29
2.20 ± 0.34
6.36 ± 0.71
42.49 ± 5.73
Cisplatin (CP)
4.39 a,b ± 0.45
1.45 a,b ± 0.17
3.50 a,b ± 0.44
28.38 a,b ± 2.93
CP + Q (5 mg/kg)
3.26 a,b,c ± 0.42
2.10 ± 0.34c
4.82 ± 0.53 a,b,c
39.85c ± 5.88
CP + Q (10 mg/kg)
3.11 a,b,c ± 0.38
2.31 ± 0.37c
5.63 ± 0.65c
42.34 ± 6.71c
3.4 Assessment of NFκb, Cox-2 and IL-6 expression immunohistochemically
The data in Fig. 3A indicate that ovarian tissues from cisplatin-treated animals showed relatively higher expression of NFκb. However, treatment with quercetin (5 and 10 mg/kg) ameliorated the rise in NFκb expression by 10% and 42% respectively. Also, expression of the inflammation markers COX-2 and IL-6 were significantly enhanced by cisplatin. The higher dose of quercetin (10 mg/kg) significantly inhibited COX-2 and IL-6 expression by 48% and 38% respectively (Fig. 3B&C).
Effect of quercetin on expression of NFκb, COX-2 and IL-6 in ovarian tissues of cisplatin-treated rats. Data are presented as Mean ± SD (n = 6). a Significant difference from Control group at p < 0.05. b Significant difference from Q at p < 0.05. c Significant difference from CP at p < 0.05. d Significant difference from CP + Q (5 mg/kg) at p < 0.05.
3.5 Effect of quercetin on TNF-α in ovaries of cisplatin-treated rats
As shown in Fig. 4, quercetin alone did not significantly alter TNF-α contents as compared to control group. However, cisplatin insult resulted in a significant increase of ovarian tissues by 140% as compared to control values. Nevertheless, quercetin at doses of 5 and 10 mg/kg significantly prevented the rise in TNF-α content by 16% and 42% respectively, as compared to cisplatin group.
Effect of quercetin on expression of TNF-α content in ovarian tissues of cisplatin-treated rats. Data are presented as Mean ± SD (n = 6). a Significant difference from Control group at p < 0.05. b Significant difference from Q at p < 0.05. c Significant difference from CP at p < 0.05. d Significant difference from CP + Q (5 mg/kg) at p < 0.05.
3.6 Impact of quercetin on cisplatin-induced ovarian apoptosis and follicle loss
Cisplatin significantly enhanced apoptotic processes in ovarian tissues as it resulted in approximately 2-fold increase in cleaved caspase-3 content. However, quercetin treatment at doses of 5 and 10 mg/kg inhibited caspase-3 increase by 22% and 42% respectively, as compared to cisplatin group (Fig. 5A). This was confirmed by assessing mRNA expression of Bax and Bcl2. Cisplatin significantly enhanced Bax expression by 105% and inhibited Bcl2 expression by 53% as compared to control animals. The higher dose of quercetin (10 mg/kg) significantly prevented the rise in Bax mRNA expression by 38% and the inhibition of Bcl2 expression by 75%, as compared to cisplatin group (Fig. 5B&C). The protective effects of quercetin were further confirmed by the significant elevations in the Bax/Bcl2 ratio observed in treatment groups as compared to cisplatin-alone group (Fig. 5D).
Effect of quercetin on expression of caspase-3 content and mRNA expression of Bax and Bcl2 in ovarian tissues of cisplatin-treated rats. Data are presented as Mean ± SD (n = 6). Statistical analysis was performed by one-way ANOVA followed by Tukey test. a Significant difference from Control group at p < 0.05. b Significant difference from Q at p < 0.05. c Significant difference from CP at p < 0.05. d Significant difference from CP + Q (5 mg/kg) at p < 0.05.
4 Discussion
Anti-cancer chemotherapy injuries ovarian follicles and promotes ovarian failure (Chen et al., 2020). Cisplatin has been reported to induce premature ovarian failure (POF) and possess damaging effects on growing and primordial ovarian follicles (Mark-Kappeler et al., 2011). Quercetin has a plethora of pharmacological activities including antioxidant, anti-inflammatory and cytoprotective effects (Wang et al., 2016). Further the beneficial biological action of quercetin in ovaries have been reviewed so that quercetin supplementation was suggested to improve ovarian functions (Rashidi et al., 2020). The current study explored the effectiveness of quercetin against cisplatin-induced ovarian toxicity in rats. The current data indicated that cisplatin injection resulted in ovarian injury evidenced by decreased number of healthy follicles with signs of edema and inflammation. This is consistent with a previous experimental study (Said et al., 2019) highlighting the ability of cisplatin to decrease proportion of healthy follicles and increase proportion of atretic follicles in rats. Quercetin significantly protected against histopathological alteration in ovarian tissues induced by cisplatin. This was confirmed by the observed amelioration of the decline in AMH which strongly correlates with the primordial follicle count (Hansen et al., 2011). However, these effects seem to be independent of the female sex hormone estradiol.
In the present work, cisplatin ovarian toxicity was shown to be mediated via oxidative stress. This is supported by a previous study that highlighted the role oxidative stress in cisplatin ovarian toxicity and infertility. Cisplatin was reported to cause accumulation of MDA and 8-hydroxy-2 deoxyguanine, GSH depletion and glutathione reductase and SOD exhaustion (Altuner et al., 2013). The observed quercetin-mediated protective effects were mediated by enhancement of the anti-oxidant mechanisms in ovarian tissues. The anti-oxidant activities of quercetin have been attributed to direct free radical scavenging effects (Oh et al., 2019), chelation of some transitional metal ions (Tang et al., 2014) and inhibition of lipid peroxidation (Wai et al., 2008). This is supported by the reported anti-oxidant activities of quercetin in ovaries (Pourteymour Fard Tabrizi et al., 2020; Rashidi et al., 2020). In addition, the obtained data indicated that cisplatin triggers inflammatory processes in the ovary. This is evidenced by increased expression of NFκb, Cox-2 and IL-6 expression as well as elevated ovarian content of TNF-α. The role of inflammatory changes in cisplatin toxicity has been previously discussed, in particular the NF-κB pathway that eventually turns on the machinery of various pro-inflammatory enzymes such as COX-2 and cytokines as IL-6 and TNF-α (Vyas et al., 2014). Therefore, inhibiting inflammatory signaling contributes to protecting ovarian tissues against cisplatin toxicity. In this regard, quercetin could significantly prevent inflammatory responses in the ovary. This is consistent with the known anti-inflammatory activities of quercetin (Li et al., 2016), which involve prevention of inflammatory cytokines as IL-6 and IL-8 and TNF-α and activation of NF-κB and other factors (Khan et al., 2016; Yang et al., 2020). Further, the antioxidant properties of quercetin may have contributed to its anti-inflammatory and its protective activities in ovarian tissues. The ability of natural abtioxidants to suppress inflammation, mitochondrial dysfunction and apoptosis in ovarian tissues has been recently reviewed (Yang et al., 2021).
To further substantiate quercetin’s protective effects, its anti-apototic activity was assessed. The present indicate that quercetin mitigated cisplatin-induced apoptosis in the ovary. This was highlighted by decreased caspase-3 content and modulation of Bax and Bcl2 expression as well as their respective ratios in ovarian tissues. This is supported by the reports indicating that quercetin supplemented food causes obvious improvement of follicular development and diminishes apoptosis of rabbits granulosa cells (Naseer et al., 2017). Further, quercetin was shown to attenuate cadmium-induced apoptosis of follicular granulosa cells from chicken ovaries (Jia et al., 2011). Mechanism of apoptotic actions of quercetin are not well illustrated. However, intervention in the JNK- and ERK pathway was suggested to mediate quercetin anti-apoptotic activities (Ishikawa and Kitamura, 2000). To the best of our knowledge, the current study revealed for the first time the ability of quercetin to attenuate cisplatin-induced ovarian toxicity in rats. This is attributed, at least partly, to its anti-oxidant, anti-inflammatory and anti-apoptotic activities.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
References
- Icariin protects against thioacetamide-induced liver fibrosis in rats: Implication of anti-angiogenic and anti-autophagic properties. Pharmacol. Reports. 2017;69:616-624.
- [CrossRef] [Google Scholar]
- Effects of quercetin on tubular cell apoptosis and kidney damage in rats induced by titanium dioxide nanoparticles. Malaysian J. Med. Sci.. 2018;25:72-81.
- [Google Scholar]
- The effect of mirtazapine on cisplatin-induced oxidative damage and infertility in rat ovaries. Sci. World J.. 2013;2013
- [CrossRef] [Google Scholar]
- Ashizawa, M., Kanda, Y., 2020. Preservation of fertility in patients with hematological malignancies. Jpn. J. Clin. Oncol. https://doi.org/10.1093/jjco/hyaa043
- Barabas, K., Milner, R., Lurie, D., Adin, C., 2008. Cisplatin: A review of toxicities and therapeutic applications. Vet. Comp. Oncol. https://doi.org/10.1111/j.1476-5829.2007.00142.x
- Bischoff, S.C., 2008. Quercetin: Potentials in the prevention and therapy of disease. Curr. Opin. Clin. Nutr. Metab. Care. https://doi.org/10.1097/MCO.0b013e32831394b8
- An age-related ovarian phenotype in mice with targeted disruption of the Cyp 19 (Aromatase) gene. Endocrinology. 2000;141:2614-2623.
- [CrossRef] [Google Scholar]
- Changes in antioxidant status of porcine ovarian granulosa cells after quercetin and T-2 toxin treatment. J. Environ. Sci. Heal. - Part B Pestic. Food Contam. Agric. Wastes. 2015;50:201-206.
- [CrossRef] [Google Scholar]
- The therapeutic effect of stem cells on chemotherapy-induced premature ovarian failure. Curr. Mol. Med.. 2020;20
- [CrossRef] [Google Scholar]
- Cho, H.W., Lee, S., Min, K.J., Hong, J.H., Song, J.Y., Kwan Lee, J., Lee, N.W., Kim, T., 2020. Advances in the treatment and prevention of chemotherapy-induced ovarian toxicity. Int. J. Mol. Sci. https://doi.org/10.3390/ijms21207792
- Synthesis, characterization and study of antioxidant activity of quercetin-magnesium complex. Spectrochim. Acta - Part A Mol. Biomol. Spectrosc.. 2015;151:807-813.
- [CrossRef] [Google Scholar]
- Correlation of ovarian reserve tests with histologically determined primordial follicle number. Fertil. Steril.. 2011;95:170-175.
- [CrossRef] [Google Scholar]
- Ho, G.Y., Woodward, N., Coward, J.I.G., 2016. Cisplatin versus carboplatin: Comparative review of therapeutic management in solid malignancies. Crit. Rev. Oncol. Hematol. https://doi.org/10.1016/j.critrevonc.2016.03.014
- Anti-apoptotic effect of quercetin: Intervention in the JNK- and ERK-mediated apoptotic pathways. Kidney Int.. 2000;58:1078-1087.
- [CrossRef] [Google Scholar]
- Quercetin attenuates cadmium-induced oxidative damage and apoptosis in granulosa cells from chicken ovarian follicles. Reprod. Toxicol.. 2011;31:477-485.
- [CrossRef] [Google Scholar]
- Zingerone ameliorates cisplatin-induced ovarian and uterine toxicity via suppression of sex hormone imbalances, oxidative stress, inflammation and apoptosis in female wistar rats. Biomed. Pharmacother.. 2018;102:517-530.
- [CrossRef] [Google Scholar]
- Molecular targets underlying the anticancer effects of quercetin: An update. Nutrients 2016
- [CrossRef] [Google Scholar]
- Immunohistochemistry for pathologists: Protocols, pitfalls, and tips. J. Pathol. Transl. Med. 2016
- [CrossRef] [Google Scholar]
- Network pharmacology study of the hepatoprotective effects of quercetin-containing traditional Chinese medicine, Anoectochilus roxburghii, and validation of quercetin as an anti-liver injury agent in a mouse model of liver injury. Med. Sci. Monit.. 2020;26
- [Google Scholar]
- Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25:402-408.
- [CrossRef] [Google Scholar]
- Mark-Kappeler, C.J., Hoyer, P.B., Devine, P.J., 2011. Xenobiotic effects on ovarian preantral follicles. Biol. Reprod. https://doi.org/10.1095/biolreprod.111.091173
- Cisplatin and Doxorubicin Induce Distinct Mechanisms of Ovarian Follicle Loss; Imatinib Provides Selective Protection Only against Cisplatin. PLoS One. 2013;8
- [CrossRef] [Google Scholar]
- Moujahed, S., Ruiz, A., Hallegue, D., Sakly, M., 2020. Quercetin alleviates styrene oxide-induced cytotoxicity in cortical neurons in vitro via modulation of oxidative stress and apoptosis. Drug Chem. Toxicol. https://doi.org/10.1080/01480545.2020.1851706
- Quercetin supplemented diet improves follicular development, oocyte quality, and reduces ovarian apoptosis in rabbits during summer heat stress. Theriogenology. 2017;96:136-141.
- [CrossRef] [Google Scholar]
- Quercetin exerts preventive, ameliorative and prophylactic effects on cadmium chloride - induced oxidative stress in the uterus and ovaries of female Wistar rats. Food Chem. Toxicol.. 2017;102:143-155.
- [CrossRef] [Google Scholar]
- Preparation of Quercetin Esters and Their Antioxidant Activity. J. Agric. Food Chem.. 2019;67:10653-10659.
- [CrossRef] [Google Scholar]
- Anti-Inflammatory Effects of Quercetin on High-Glucose and Pro-Inflammatory Cytokine Challenged Vascular Endothelial Cell Metabolism. Mol. Nutr. Food Res.. 2021;2000777
- [CrossRef] [Google Scholar]
- Quercetin and polycystic ovary syndrome, current evidence and future directions: A systematic review. J. Ovarian Res. 2020
- [CrossRef] [Google Scholar]
- Quercetin attenuates visceral hypersensitivity and 5-hydroxytryptamine availability in postinflammatory irritable bowel syndrome rats: Role of enterochromaffin cells in the colon. J. Med. Food. 2019;22:663-671.
- [CrossRef] [Google Scholar]
- Rashidi, Z., Khosravizadeh, Z., Talebi, A., Khodamoradi, K., Ebrahimi, R., Amidi, F., 2020. Overview of biological effects of Quercetin on ovary. Phyther. Res. https://doi.org/10.1002/ptr.6750
- Mechanistic perspective of protective effects of resveratrol against cisplatin-induced ovarian injury in rats: emphasis on anti-inflammatory and anti-apoptotic effects. Naunyn. Schmiedebergs. Arch. Pharmacol.. 2019;392:1225-1238.
- [CrossRef] [Google Scholar]
- From chemotherapy to biological therapy: A review of novel concepts to reduce the side effects of systemic cancer treatment (Review) Int. J. Oncol.. 2019;54:407-419.
- [CrossRef] [Google Scholar]
- Quercetin attenuates chronic ethanol hepatotoxicity: Implication of “free” iron uptake and release. Food Chem. Toxicol.. 2014;67:131-138.
- [CrossRef] [Google Scholar]
- Vyas, D., Laput, G., Vyas, A.K., 2014. Chemotherapy-enhanced inflammation may lead to the failure of therapy and metastasis. Onco. Targets. Ther. https://doi.org/10.2147/OTT.S60114
- Quercetin and its in vivo metabolites inhibit neutrophil-mediated low-density lipoprotein oxidation. J. Agric. Food Chem.. 2008;56:3609-3615.
- [CrossRef] [Google Scholar]
- Quercetin exerts antidepressant and cardioprotective effects in estrogen receptor α-deficient female mice via BDNF-AKT/ERK1/2 signaling. J. Steroid Biochem. Mol. Biol.. 2021;206
- [CrossRef] [Google Scholar]
- Quercetin increases the antioxidant capacity of the ovary in menopausal rats and in ovarian granulosa cell culture in vitro. J. Ovarian Res.. 2018;11
- [CrossRef] [Google Scholar]
- Wang, W., Sun, C., Mao, L., Ma, P., Liu, F., Yang, J., Gao, Y., 2016. The biological activities, chemical stability, metabolism and delivery systems of quercetin: A review. Trends Food Sci. Technol. https://doi.org/10.1016/j.tifs.2016.07.004
- Yang, D., Wang, T., Long, M., Li, P., 2020. Quercetin: Its Main Pharmacological Activity and Potential Application in Clinical Medicine. Oxid. Med. Cell. Longev. https://doi.org/10.1155/2020/8825387
- Yang, L., Chen, Y., Liu, Y., Xing, Y., Miao, C., Zhao, Y., Chang, X., Zhang, Q., 2021. The role of oxidative stress and natural antioxidants in ovarian aging. Front. Pharmacol. https://doi.org/10.3389/fphar.2020.617843
- Antitumor activities of quercetin and quercetin-5’,8-disulfonate in human colon and breast cancer cell lines. Food Chem. Toxicol.. 2012;50:1589-1599.
- [CrossRef] [Google Scholar]
- Zhu, H., Luo, H., Zhang, W., Shen, Z., Hu, X., Zhu, X., 2016. Molecular mechanisms of cisplatin resistance in cervical cancer. Drug Des. Devel. Ther. https://doi.org/10.2147/DDDT.S106412
