Translate this page into:
Research on the conversion pattern of 6-gingerol in stir-fried ginger and the protective activity mechanism of its conversion products on HUVECs
*Corresponding authors: E-mail addresses: hyquan2003@163.com (Y. Han); hyan2003@163.com (Y Hong)
-
Received: ,
Accepted: ,
Abstract
Gingerol compounds are the main active and spicy components in ginger, among which 6-gingerol has the highest content. Gingerol compounds have an unstable structure due to multiple phenolic hydroxyl groups. During drying, heating, and processing, the gingerol component can be decomposed and converted, which is a primary factor contributing to the varied pharmacological effects of processed ginger products. However, the specific conversion pattern and activity changes of gingerol components before and after conversion are still unclear. This study aims to observe the conversion mechanism of 6-gingerol during the processing of dried ginger into stir-fried ginger, using 6-gingerol as a representative compound. Furthermore, by investigating its mechanism of protecting vascular endothelial cells, this study provides experimental evidence for the changes in the pharmacological effects of 6-gingerol and ginger during processing. Traditionally, the sand-frying method was used to process dried ginger, and it was verified that 6-gingerol could be converted into 6-shogaol and zingerone during the processing. Subsequently, the use of 6-gingerol monomer to simulate the changes in stir-fried ginger further confirmed the conversion of its components. On the other hand, network pharmacology methods were used to predict the mechanisms by which 6-shogaol, zingerone, and 6-gingerol protect human umbilical vein endothelial cells (HUVECs). The LPS-induced HUVECs injury model experiment was used to verify the differential protective effects of 6-shogaol, zingerone, and 6-gingerol on HUVEC injury. The results showed that with the extension of frying time and the increase of temperature, the content of 6-shogaol and zingerone in stir-fried ginger gradually increased, while the content of 6-gingerol decreased with time. The simulated processing experiment of 6-gingerol monomer also confirmed that during the oil bath heating process, a portion of 6-gingerol is converted into 6-shogaol and zingerone. Network pharmacology and cell experiments have shown that 6-shogaol, zingerone, and 6-gingerol improve inflammation and oxidative stress responses in HUVECs, reduce the expression of genes and proteins related to ferroptosis and apoptosis, and their effects are related to the activation of the PI3K-AKT-NRF2 pathway. The conclusion of the study is that when dried ginger is processed into stir-fried ginger, 6-gingerol is partially converted into 6-shogaol and zingerone, and all three components have a protective effect on the LPS-induced HUVECs injury model, with 6-shogaol having stronger activity.
Keywords
6-gingerol
Conversion pattern
Network pharmacology
PI3K-AKT-NRF2 signalling pathway
Stir-fried ginger
1. Introduction
Before traditional Chinese herbs are used to treat diseases, they are generally processed using specific methods based on Traditional Chinese Medicine (TCM) theory to ensure compatibility and prescription [1]. There are several common processing methods, such as stir frying, steaming, boiling, etc [2]. These processing methods, which require heating, usually cause changes in the chemical composition or structure of TCM and may also lead to the production of new compounds. The changes in these chemical components can lead to different characteristics in the absorption process and bioavailability of processed Chinese medicine compared to the original medicinal materials, thereby affecting the changes in the efficacy of Chinese medicine, such as increasing efficacy, reducing toxicity, and changing medicinal properties [3]. Therefore, TCM usually manifests as “different treatments for raw and cooked”, which means that the Chinese medicine before and after processing can generally be used to treat different diseases [4]. From this, it can be inferred that by studying the changes in active ingredients during the processing, the mechanism of component changes in Chinese medicine after processing can be elucidated in vitro. Furthermore, by combining pharmacology or in vivo pharmacokinetic studies, it may be possible to clarify the mechanism of component changes in disease treatment.
Ginger (Zingiber officinale Rose.) is one of the most common foods and spices in the world, especially popular in East Asia [5]. In China, ginger is also a common TCM, used alone or in herbal formulas to treat various diseases. Ginger has various processing methods, such as fresh ginger, stewed ginger, dried ginger, stir-fried ginger, and ginger charcoal. Among them, dried ginger and sand-fried ginger are more commonly used [6]. Dried ginger is the dried rhizome of ginger in the ginger family, characterized by its spicy taste and warm nature. It has the effects of warming the spleen and stomach, dispelling cold and nourishing qi, promoting qi and blood circulation, warming the lungs, and aiding digestion [7]. Stir-fried ginger is made by stir-frying dried ginger with sand as an auxiliary ingredient at a specific temperature for a certain period of time. According to TCM theory, stir-frying ginger with sand at high temperatures can enhance its warmth and hemostatic activity, reduce its spiciness, and is mainly used clinically to treat bleeding caused by deficiency-cold conditions [8]. Research has confirmed that the chemical composition of dried ginger undergoes changes after processing, with some chemical components decreasing or disappearing, while new components are produced [4]. The changes in the chemical composition of stir-fried ginger may be the reason for its increased hemostatic activity.
Gingerol components are the main pungent and active substances in ginger, possessing some medicinal properties, including antioxidant, anti-inflammatory, antipyretic, neuroprotective, and anti-tumor [9-12]. Gingerol components in ginger have the highest content of 6-gingerol, also the indicator component for the content determination of ginger and its processed products in the 2020 edition of the Chinese Pharmacopoeia. Earlier research indicates that once dried ginger is processed into stir-fried ginger, the gingerol components diminish noticeably, particularly 6-gingerol, which decreases from 15% to 42%. Despite this reduction, the levels of shogaol and other compounds rise substantially, and an entirely new component, zingerone, emerges during this conversion. The conversion of ingredients and the generation of new ones often have a significant impact on the performance of drugs, which is very common in research in the field of building materials and other fields [13-15]. However, the specific conversion mechanism of gingerol components during processing and their impact on pharmacological activity have not been systematically elucidated, which hinders the determination of ginger processing technology parameters and the in-depth exploration of the mechanism of pharmacological changes.
Vascular endothelial cells are pivotal components of blood vessel structure, and any anomalies in their function or structure can lead to complications like vessel wall coagulation, resulting in a series of vascular-related diseases [16,17]. According to research, oxidative stress and inflammation are the primary pathogenic mechanisms that lead to the development of cardiovascular diseases such as atherosclerosis and blood stasis syndrome and cause vascular endothelial injury (VEI) [18]. Research has shown that gingerol compounds can protect endothelial function by inhibiting the release of inflammatory factors such as Interleukin 1β (IL-1β) and Tumour Necrosis Factor -α (TNF -α) and regulating the Nuclear factor erythroid-2-related factor 2 (NRF2) antioxidant pathway [19]. It is worth noting that ferroptosis, as an iron-dependent lipid peroxidation-driven cell death form, plays a key role in endothelial injury, and NRF2, as its negative regulatory factor, can inhibit the process of ferroptosis by activating the glutathione metabolic pathway [20]. This indicates that exploring the intervention effects of gingerol and its conversion products on ferroptosis-related pathways may provide new directions for interpreting the molecular mechanisms of functional changes in dried ginger processed into stir-fried ginger.
Based on the above research results, this study focuses on 6-gingerol as the research object to explore its conversion pattern and mechanism during the processing of dried ginger into stir-fried ginger, revealing its mechanism of protecting vascular endothelial cells and providing a scientific basis for optimizing the processing technology of dried ginger and elucidating the protective mechanism of vascular endothelial cells. The changes of 6-gingerol during the processing of dried ginger into stir-fried ginger, the heating changes of 6-gingerol monomers, and the combination of network pharmacology and in vitro cell validation methods have been used to explore the protective effects and potential mechanisms of 6-gingerol and its conversion products on human umbilical vein endothelial cells (HUVECs).
2. Materials and Methods
2.1. Materials and reagents
6-Shogaol (purity ≥ 98.0%, DST190623-030), zingerone (purity ≥ 98.0%, DST190513-032), 6-gingerol (purity ≥ 98.0%, 13012303), and the controls were purchased from Chengdu Desert Bio-technology Co. Dried ginger slices (20191012) were purchased from Tongling Hetian Traditional Chinese Medicine Drinks Co. endothelial cell medium (ECM), fetal bovine serum (FBS), and endothelial cell growth supplement (ECGS) were purchased from Sciencell Co., USA. Lipopolysaccharide (LPS) was purchased from Biosharp Co., cell counting kit-8 (CCK8) was purchased from Albatross Biotechnology Co., and Hoechst 33258 was supplied by Soleibao. The Phosphatidylinositol 3-kinase (PI3K), protein kinase B (Akt), NRF2, Bcl-2-associated X protein (BAX), B-cell lymphoma-2 (Bcl-2), Glutathione peroxidase 4 (GPX4), and Solute carrier family 7 member 11 (SLC7A11) primers were acquired from Xinbei Biotechnology Co. in Shanghai. Meanwhile, the antibodies for PI3K, phosphorylated PI3K, P-PI3K, BAX, BCL-2, and GPX4 were sourced from Abcam Co. Antibodies AKT and P-AKT were purchased from CST Co. Antibody NRF2 was purchased from Santa Cruz Co. Antibody SLC7A11 was purchased from Bioss Co.
2.2. Effect of different sand frying processes on the content of 6-shogaol, zingerone and 6-gingerol in dried ginger and stir-fried ginger
2.2.1. Preparation of test and control solutions
The preparation of stir-fried ginger by different processes was referred to the previous research method of the group: 100 g of net dried ginger slices were weighed for each portion, one portion was kept for reserve, and the rest were stir-fried with sand at 170, 190, and 210°C for 6, 7, and 8 min, respectively.
Take dried ginger, each group stirs fried ginger powder (through a 40-mesh sieve) about 0.5 g. Precision adds MeOH 20 mL, and ultrasonic treatment (Power 150 W, Frequency 40 kHz) for 30 min.
Precisely weigh the appropriate amount of 6-shogaol and zingerone, 6-gingerol control, made of control mother liquor refrigerated standby, and then sucked up a certain amount of control mother liquor, add MeOH to make the mass concentration of 0.073, 0.014, and 0.139 mg/mL of the mixture of the standard solution, respectively.
2.2.2. Content determination and UPLC conditions
The sample’s three components were examined using ultra-performance liquid chromatography (UPLC) with an Agilent ZORBAX Eclipse Plus C18 column (2.1 × 100 mm, 1.8 μm). The analysis employed acetonitrile (A) and an aqueous solution (B) as the mobile phases. Gradient elution: 0 to 12 min, 10% →68%A; 12 to 17 min, 68%A; 17 to 18 min, 68→78%A; 18 to 24 min, 78%A; 24 to 25 min, 78→10%A, 25 to 27 min, 10%A. Detection wavelength: 280nm, flow velocity: 0.2 mL/min, column temp: 30°C, sample injection: 2 μL.
2.3. Simulated processing method to explore the conversion pattern of 6-gingerol
Referring to the previous research methods, accurately weigh about 5 mg of 6-gingerol reference substance, and oil bath heating at 170, 190, 210, and 230°C for 8 min, cool it down, and dissolve it in methanol to a certain volume to obtain the simulated processed test solution of 6-gingerol. The contents of the conversion products 6-shogaol, zingerone, and the prototype component 6-gingerol under different oil bath heating conditions were analyzed by UPLC.
2.4. Network pharmacology analysis
2.4.1. Analysis of the drug-like properties of 6-gingerol and its conversion products
The Lipinski rule (LR) is a classic method for analyzing the potential of compounds to become drugs, and it is widely used in the study of natural products [21]. Relevant parameters for 6-shogaol, zingerone, and 6-gingerol were retrieved from the Molinspiration website (https://www.molinspiration.com/). Using the LR class of drug properties, these compounds were evaluated against specific criteria: a relative molecular weight (MW) of no more than 500 Da, a maximum of 5 hydrogen-bonding donors, a limit of 10 hydrogen-bonding acceptors, and a lipid-water partition coefficient capped at 4.15. If the compound violates more than two of these conditions, the compound has relatively low drug-like properties.
2.4.2. Prediction of targets of action of 6-gingerol and its conversion product
Target prediction for 6-shogaol, zingerone, and 6-gingerol was conducted through the Swiss Target Prediction database (http://www.swisstargetprediction.ch/).
2.4.3. Collection of targets concerning VEI
GeneCards (https://www.genecards.org/) was used to explore targets concerning VEI using the keyword “Vascular endothelial injury,” download the table, and delete the duplicate genes to obtain the disease genes related to VEI.
2.4.4. Creating interactions between “component-target” networks
The intersecting targets of 6-shogaol, zingerone, and 6-gingerol on VEI were obtained from the Venn database, and the “component-target” networks were visualized through Cytoscape 3.8.0 software.
2.4.5. Building networks of protein-protein interactions (PPI)
To gather the PPI data for the three components acting on the targets of VEI, the STRING online database (https://string-db.org/) was employed. A visual representation and a topological examination were then conducted using the Cytoscape 3.8.0 software.
2.4.6. Enrichment analysis
DAVID (https://david.ncifcrf.gov/) conducted GO and KEGG enrichment analysis on the intersecting targets. The p<0.05 terms were gathered and organized in descending order of p-value. The leading 20 outcomes were chosen for visualization and analysis by Microbiology Letter (https://www.bioinformatics.com.cn/login/).
2.4.7. Building “component-target-pathway” network interactions
Analyzed component targets, VEI targets, and pathways using Cytoscape 3.8.0.
2.4.8. Molecular docking
PubChem (http://pubchem.ncbi.nlm.nih.gov/) offered the 2D structures of the compounds. The RCSB-PDB (https://www.rcsb.org/) database allows users to download the 3D structures of PI3K (PDB code: 4GPS), AKT (PDB code: 1H10), and NRF2 (PDB code: 7X5E). The PyMOL 2.6.0 software was used for protein dehydration and phosphate elimination. Meanwhile, the Molecular Operating Environment 2019 software was employed to reduce the energy levels of the compounds, prepare the target proteins, and identify the active sites. In conclusion, the MOE 2019 program facilitated 50 molecular docking runs. The molecules’ binding affinity was evaluated via their binding energy, and the results were depicted with PyMOL 2.6.0 and Discovery Studio 2019.
2.5. Experimental validation
2.5.1. Culture of HUVECs
HUVECs were grown in ECM medium containing 5% FBS, 1% P/S, and 1% ECGS within a 37°C incubator containing 5% CO2, and the cells showed paving-stone-like adherence to the wall.
2.5.2. Cell viability assay
HUVECs were seeded in 96-well plates and treated with 6-shogaol, zingerone, and 6-gingerol at concentrations ranging from 5 to 100 μg/mL, along with LPS at doses between 10 and 150 μg/mL. This treatment was conducted for 24 h.
The preliminary experiments yielded outcomes, prompting us to select 5-20 μg/mL concentrations of 6-shogaol, zingerone, and 6-gingerol for the cell viability test. These compounds were used to pre-treat the cells for 2 h. Subsequently, the cells were subjected to a 24-h treatment with 30 μg/mL LPS. A mere 10 μL of the CCK-8 solution was introduced into each well, after which the cells were incubated in a controlled setting for another 2 h. The absorbance of each treatment group was subsequently measured using an enzyme marker at a wavelength of 450 nm.
2.5.3. Morphological observation of cells
The HUVECs were categorized into several groups: a control (normal) group, LPS (30 µg/mL), LPS+6-shogaol (20 µg/mL), LPS+zingerone (20 µg/mL), LPS+6-gingerol (20 µg/mL). Each group underwent a 2-h pre-treatment with their respective substances before LPS was introduced for a 24-h exposure. Observations and photographs were recorded with an Olympus CX53 inverted fluorescence microscope (Olympus, Japan).
2.5.4. Hoechst 33258 staining
After culturing cells in groups, each experimental group underwent a 2-h pre-treatment with 6-shogaol, zingerone, or 6-gingerol before being exposed to LPS for an additional 24 h. 4% paraformaldehyde fixed cells for 1 h. After rinsing, the cells were stained with 1 mL of Hoechst 33258 in each well and shielded from light for 10 min. The cells underwent analysis via a fluorescence microscope.
2.5.5. ROS, SOD, MDA, GSH assays
After culturing cells in groups. Each experimental group underwent a 2-h pre-treatment with 6-shogaol, zingerone, or 6-gingerol before being exposed to LPS for an additional 24 h. Reactive oxygen species (ROS), Superoxide dismutase (SOD), Malondialdehyde (MDA), and Glutathione (GSH) concentrations were measured as per the provided kit guidelines.
2.5.6. Inflammatory cytokine testing
Each experimental group underwent a 2-h pre-treatment with 6-shogaol, zingerone, or 6-gingerol before being exposed to LPS for an additional 24 h. Following the provided protocols, the IL-1β and TNF-α concentrations were assessed via the respective kits.
2.5.7. Detection of iron ions
Cellular iron ion level was determined by ferrous microplate assay. Each experimental group underwent a 2-h pre-treatment with 6-shogaol, zingerone, or 6-gingerol before being exposed to LPS for an additional 24 h. Cell homogenates were collected, the supernatants were centrifuged at low speed, and the iron level was measured per the provided kit guidelines.
2.5.8. Quantitative real-time polymerase chain reaction (qRT-PCR) for mRNA expression detection
Total RNA isolation from cellular specimens was achieved with TRIzol, and cDNA synthesis was performed with the PrimeScript™ RT kit. cDNA was synthesized using SYBR Green I nucleic acid gel stain (SYBR Green I) mixture. cDNA was used to perform a fluorescence quantitative PCR reaction. Employing β-actin as a standard, gene expression levels were assessed using the 2-ΔΔCt approach. The primer sequences can be found in Table 1.
| Gene |
Amplicon size (bp) |
Forward primer (5’→3’) |
Reverse primer (5’→3’) |
|---|---|---|---|
| β-actin | 96 | CCCTGGAGAAGAGCTACGAG | GGAAGGAAGGCTGGAAGAGT |
| PI3K | 138 | TGTGGAGCTCGCTAAAGTCA | CACTCCTGCCCTAAATGGGA |
| AKT | 167 | CTTTCGGCAAGGTGATCCTG | GTACTTCAGGGCTGTGAGGA |
| NRF2 | 104 | CGCAGACATTCCCGTTTGTA | AGCAATGAAGACTGGGCTCT |
| Bax | 137 | CATGGGCTGGACATTGGACT | AAAGTAGGAGAGGAGGCCGT |
| Bcl-2 | 103 | GCGGCCTCTGTTTGATTTCT | TCACTTGTGGCCCAGATAGG |
| GPX4 | 136 | CAGGAGCCAGGGAGTAAC | CCTTGGGTTGGATCTTCA |
| SLC7A11 | 75 | GAGGTGGAGAATTGAGAGCA | GCTTTTTCCTTCACAGCGAT |
2.5.9. The expression of relevant proteins was assessed using Western blot
Collect cell samples and add radioimmunoprecipitation assay buffer (RIPA) to lyse cells. The bicinchoninic acid (BCA) protein assay kit was employed to determine the protein concentration. The samples underwent separation via SDS-PAGE at a steady voltage of 80 V for 1 h. Following this process, transfer the protein to a polyvinylidene fluoride (PVDF) membrane and then secure it for 2 h. Store overnight in a primary antibody dilution solution (1:1000 for PI3K, AKT, P-PI3K, NRF2, Bcl-2; 1:1500 for SLC7A11; 1:2000 for GAPDH, P-AKT, GPX4; 1:5000 for Bax). Incubate the sample with a secondary antibody labeled with HRP for 1.2 h. Proteins were detected using the ECL luminescence kit, and film strip analysis was performed using Image J 2.0 software.
2.6. Data analysis
Data are expressed as mean ± standard deviation. Statistical evaluations were performed with GraphPad 8.0.1, using a significance level of P < 0.05 as the criterion for statistical significance.
3. Results and Discussions
3.1. Effect of different sand frying processes on the content of 6-shogaol, zingerone, and 6-gingerol in dried ginger and stir-fried ginger
The contents of 6-shogaol, zingerone, and 6-gingerol in different stir-fried ginger have been shown in Figure 1. As the duration of sand blanching was extended and temperatures rose, the contents of conversion products 6-shogaol and zingerone steadily rose, while the content of the prototypical component 6-gingerol monomer gradually decreased. Among them, no zingerone was detected in the dried ginger and the stir-fried ginger of sand frying conditions at 170°C for 6 min, and the production of zingerone was detected at the designated temperature thresholds, sand frying at 170°C for 7 min and at 190°C for 6 min, which indicated that zingerone was a newly produced component of dried ginger after sand frying.
- Effect of different sand frying processes on the content of 6-shogaol, zingerone and 6-gingerol in dried ginger and stir-fried ginger. (a) UPLC plots, S1: dried ginger, S2: stir-fried ginger, S3:control, 1:zingerone; 2:6-gingerol; 3: 6-shogaol. Impact of varied sand-frying temperatures and durations on the concentration of (b) 6-shogaol, (c) zingerone and (d) 6-gingerol in dried ginger.
3.2. Simulated processing method to explore the conversion pattern of 6-gingerol
The trends of the three components with time and temperature are illustrated in Figures 2(a-e), while Table 2 displays the specific content changes. Evidently, at 190°C or less, the levels of 6-shogaol and zingerone progressively rose as the oil bath heating extended. As the temperature climbs to 210°C or higher, extending the duration of the oil bath heating initially increases its content, followed by a subsequent decrease. The levels of 6-gingerol have declined as the temperature and duration of oil bath heating rise. When the oil bath temperature was 170°C, its decreasing trend was slower with the prolonging of the oil bath heating time. When the oil bath heating temperature reached 190 °C and 6 min, its content decreased significantly. The results of the simulated concoction in this experiment confirmed that 6-shogaol and zingerone were generated from 6-gingerol after oil bath heating, and the main mechanism was that 6-shogaol was generated from 6-gingerol by dehydration reaction at a certain temperature. The inverse hydroxyl-aldehyde condensation reaction to generate zingerone was significantly triggered when the temperature reached 210°C. The conversion mechanism has been shown in Figure 2(f).
- Conversion pattern of 6-gingerol. (a) 6-gingerol, (b) 6-gingerol in oil bath at 170°C for 8 min, (c) 6-gingerol in oil bath at 190°C for 8 min, (d) 6-gingerol in oil bath at 210°C for 8 min, (e) 6-gingerol in oil bath at 230°C for 8 min, (f) 6-gingerol conversion mechanism diagram. 1: zingerone; 2:6-gingerol; 3: 6-shogaol.
| Time (min) | 6-shogaol(μg/mg) | zingerone(μg/mg) | 6-gingerol(μg/mg) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 170°C | 190°C | 210°C | 230°C | 170°C | 190°C | 210°C | 230°C | 170°C | 190°C | 210°C | 230°C | |
| 0 | 0 | 0 | 869.17 | |||||||||
| 4 | 83.35 | 164.97 | 348.46 | 289.89 | 2.08 | 4.79 | 19.63 | 87.87 | 802.75 | 702.26 | 519.35 | 389.13 |
| 6 | 104.83 | 316.70 | 491.69 | 417.29 | 2.56 | 9.71 | 31.88 | 59.25 | 813.70 | 673.75 | 288.26 | 88.70 |
| 8 | 144.09 | 361.70 | 525.63 | 343.51 | 4.11 | 13.69 | 32.88 | 56.43 | 770.39 | 496.49 | 172.01 | 71.93 |
| 10 | 232.81 | 443.38 | 444.78 | 316.07 | 3.18 | 14.66 | 51.87 | 74.25 | 686.03 | 438.71 | 109.46 | 24.30 |
| 12 | 249.52 | 433.64 | 410.88 | 185.83 | 6.20 | 16.66 | 41.20 | 51.83 | 780.23 | 368.85 | 107.04 | 51.04 |
3.3. Network pharmacological analyses
3.3.1. Examination of the drug-like properties of 6-gingerol and its conversion products
The conversion products 6-shogaol, zingerone, and the prototype component 6-gingerol were submitted to the Molinspiration platform and evaluated based on the LR principle. Table 3 presents the findings, illustrating that 6-shogaol, zingerone, and 6-gingerol align with the LR principle, and therefore, they can be considered as the active ingredients.
| Chemical composition | Molecular formula | MW | n-OH | n-OHNH | miLogP |
|---|---|---|---|---|---|
| 6-shogaol | C17H24O3 | 276.4 | 3 | 1 | 4.35 |
| zingerone | C11H14O3 | 194.23 | 3 | 1 | 1.52 |
| 6-gingerol | C17H26O4 | 294.4 | 4 | 2 | 3.22 |
3.3.2. Interaction network between 6-gingerol and its conversion product targets and VEI targets
Through Swiss Target Precision and PharmMapper databases, 255 targets corresponding to the three components were obtained. Through GeneCards and OMIM databases, 985 potential targets of VEI were obtained. A Venn diagram was made to show how the component targets and the VEI targets overlap, revealing a total of 172 intersected targets, and the detailed information of the intersection and intersected targets is shown in Figure 3(a). Meanwhile, a “component-target” network graph was established, shown in Figure 3(b), in which 361 edges and 175 nodes were discovered. Among these edges, the highest degree of connectivity was 6-gingerol (degree=136), followed by 6-shogaol (degree=128) and zingerone (degree=97), which revealed that these three components may have certain protective effects against endothelial damage and are multi-component and multi-target.
- Related targets and pathways of 6-gingerol and its conversion products on VEI.(a) Venn diagram of 6-shogaol, zingerone and 6-gingerol targets and VEI targets (b) Component-target interaction network diagrams. (c) PPI interaction network diagram of 6-shogaol, zingerone and 6-gingerol with VEI. (d) GO functional enrichment. (e) KEGG bubble plot.
3.3.3. Building networks of PPI
As illustrated in Figure 3(c), the network comprises 139 nodes interconnected by 1,688 edges. In this representation, the size of each node correlates with its degree value, whereby larger nodes are depicted in darker hues, indicating that the node is approximately as highly associated with the other proteins. Targets were screened by the average values of the associated parameters Betweenness, Closeness and Degree, and the top 10 greater than their average values were selected as key targets, including SRC, PIK3R1, PIK3CA, GRB2, HSP90AA1, STAT3, HRAS, MAPK3, MAPK1, PTPN11, AKT1, etc. (Table 4), which may be potential targets for 6-gingerol and its conversion products to protect against VEI.
| Target | Degree | Betweenness | Closeness |
|---|---|---|---|
| SRC | 118 | 2778.266 | 0.253653 |
| PIK3R1 | 102 | 796.3409 | 0.281569 |
| PIK3CA | 96 | 616.0805 | 0.299645 |
| GRB2 | 88 | 870.1963 | 0.326638 |
| HSP90AA1 | 84 | 1225.525 | 0.228804 |
| STAT3 | 80 | 1256.498 | 0.311538 |
| HRAS | 80 | 975.1185 | 0.302564 |
| MAPK3 | 78 | 955.767 | 0.310391 |
| MAPK1 | 78 | 923.9092 | 0.300945 |
| PTPN11 | 76 | 291.4793 | 0.376956 |
3.3.4. Enrichment analysis
We examined GO and KEGG enrichment analyses on the overlapping genes to investigate the possible mechanisms by which 6-gingerol and its conversion products influence VEI. The circle graph illustrated the top 10 results for the GO-BP, GO-CC, and GO-MF enrichment categories, respectively (Figure 3d), suggesting that 6-gingerol and its conversion products may affect VEI in a variety of ways, such as through inhibition of apoptosis and stimulation of phosphatidylinositol 3-kinase signaling. The bubble diagram shows the top 20 KEGG entries (Figure 3e). Among these potential pathways, excluding tumor pathways of low relevance, the highest scoring was the PI3K-AKT pathway.
3.3.5. Analysis of “component-target-pathway “network interaction results
The findings have been illustrated in Figure 4. The network was analyzed, and the degree value was calculated. Except for the first-place cancer pathway with a lower correlation, the PI3K-AKT signaling pathway emerged as the most likely candidate, boasting a degree value of 47, which positions it just behind the leading cancer pathway and is deemed the most probable pathway. Based on the findings from the enrichment analysis, we hypothesized that the conversion products 6-shogaol and zingerone, together with the prototypical component 6-gingerol, might regulate their downstream target genes and target proteins through the PI3K-AKT pathway, which in turn could affect VEI.
- ”Component-target-pathway” network diagram.
3.3.6. Molecular docking
Molecular docking studies investigated the potential interactions between 6-gingerol and its conversion products with the predicted pathway. As shown in Table 5, the molecular docking energies varied between -4.6129 and -6.3674 kcal/mol. This suggests all eight docking groups exhibited strong binding activity, while one group demonstrated moderate binding capability. Among them, 6-shogaol-PI3K (-6.4 kcal/mol), 6-shogaol-AKT (-6.0 kcal/mol), and 6-gingerol-NRF2 (-5.8 kcal/ mol) were shown to have lower binding energies in their respective corresponding targets. As shown in Figure 5.
| Component | BE (affnity kcal/mol) | ||
|---|---|---|---|
| PI3K | AKT | NRF2 | |
| 6-shogaol | -6.4 | -6.0 | -5.3 |
| zingerone | -6.0 | -5.2 | -4.6 |
| 6-gingerol | -6.3 | -5.9 | -5.8 |
- Molecular docking pattern diagram of 6-shogaol, zingerone and 6-gingerol with the targets PI3K, AKT and NRF2: (a) 6-shogaol and PI3K, (b) 6-shogaol and AKT, (c) 6-shogaol and NRF2, (d) zingerone and PI3K (e) zingerone and AKT, (f) zingerone and NRF2, (g) 6-gingerol and PI3K, (h) 6-gingerol and AKT, (i) 6-gingerol and NRF2.
3.4. Experimental verification
3.4.1. Effect of 6-gingerol and its conversion product on LPS-induced HUVECs viability
Different concentrations of drugs, ranging from 5-100 μg/mL, were selected to treat the cells for 24 h. As illustrated in Figure 6(a), when the drug concentrations were set between 5 and 20 μg/mL, none of the three compounds exhibited notable cytotoxic effects on HUVECs. However, upon raising the drug concentrations to 40 μg/mL, all three compounds began to display varying degrees of cytotoxicity towards HUVECs. Therefore, subsequent experiments determined that the concentration of the three drugs fell between 5 and 20 μg/mL. The effects of different concentrations of LPS on HUVECs have been shown in Figure 6(b). LPS decreased the survival rate of HUVECs in a way that depended on its concentration, with an IC50 value calculated at 33.93 μg/mL. Consequently, the concentration of LPS selected for modeling purposes was set at 30 μg/mL.
- 6-gingerol and its conversion products alleviate LPS-induced damage in HUVECs. (a) Effects of 6-shogaol, zingerone and 6-gingerol on cell viability. (b) Effect of LPS on HUVECs viability. (c-e) Effect of 6-shogaol, zingerone and 6-gingerol on LPS-induced HUVECs viability. (f) Morphological changes of HUVECs. (g) Hoechst 33258 staining.
Figures 6(c-e) illustrates the impact of three compounds on the damage inflicted on LPS-induced HUVECs. The findings indicated that cell viability in the LPS group was markedly reduced compared to the control group. In contrast, treatment with 6-shogaol, zingerone, and 6-gingerol resulted in a substantially improved cell viability for HUVECs relative to the model group.
3.4.2. Effect of 6-gingerol and its conversion product on cell morphology after LPS-induced injury in HUVECs
Morphological changes of the cells are depicted in Figure 6(f). In the control group, the cells appeared healthy, with a full shape, a long shuttle shape, tight rows of cells, and a “paving-stone” shape between cells. In contrast to the control group, the HUVEs in the LPS group appeared shriveled and shorter in stature, exhibiting a decreased cell count and noticeable spaces between cells. Additionally, a significant amount of suspended cells and cellular debris was observed floating in the culture medium. Compared with the LPS model group, the LPS+6-shogaol, LPS+zingerone, and LPS+6-gingerol administration groups showed significant improvement in cell morphology and reduction in suspended cells and cellular debris, which indicated that all three administration groups increased cell density and cell viability.
3.4.3. Effect of 6-gingerol and its conversion product on Hoechst 33258 staining after LPS-induced injury in HUVECs
The morphological changes of HUVECs were observed using Hoechst 33258 staining, which was also utilized to examine the effects of three compounds on apoptosis (Figure 6g). HUVECs in the control group had uniform morphology, with rounded, unbroken nuclei, but cells in the LPS-treated model group had irregular nuclei, including wrinkles and nuclear rupture. In contrast to the LPS model group, LPS+6-shogaol, LPS+zingerone, and LPS+6-gingerol administration groups reduced the morphological changes of the nuclei and improved the apoptosis of HUVECs.
3.4.4. 6-gingerol and its conversion products attenuate LPS-induced oxidative stress levels in HUVECs
To explore the impact of 6-gingerol and its conversion products on LPS induced oxidative stress in HUVECs, we experimentally assessed the expression levels of ROS, SOD, MDA, and GSH. Based on Figure 7(a-d), after 24 h of LPS exposure, the levels of ROS and MDA (Figure 7c) were substantially higher (P<0.01) than those of the normal group. In contrast, those of SOD and GSH were considerably lower than those of the normal group (P<0.01). When compared to the LPS group, the LPS+6-shogaol, LPS+zingerone, and LPS+6-gingerol groups were able to significantly reduce the levels of ROS and MDA and elevate the levels of SOD and GSH (P<0.01). The results indicated that the three compounds effectively ameliorated LPS-induced oxidative stress injury in HUVECs.
- 6-gingerol and its conversion products alleviate LPS-induced oxidative stress, inflammation, and intracellular iron ion levels in HUVECs. (a) Expression of ROS, (b) Expression of SOD, (c) Expression of MDA, (d) Expression of GSH, (e) Expression of TNF-α, (f) Expression of IL-1β, (g) Expression of Iron.
3.4.5. 6-gingerol and its conversion products reduce LPS-induced inflammatory response and iron ion levels in HUVECs
According to Figures 7(e-g), in comparison to the normal group, LPS markedly enhanced the expression of TNF-α (Figure 7e), IL-1β (Figure 7f), and ferric ions (Figure 7g) in HUVECs after 24 h of induction (P<0.01). This was significantly reversed in the LPS+6-shogaol, LPS+zingerone, and LPS+6-gingerol treatment groups compared to the LPS group (P<0.01), indicating that both the conversion products 6-shogaol and zingerone and the prototype component 6-gingerol reduced LPS-induced inflammatory response and the accumulation of iron ions in HUVECs.
3.4.6. qRT-PCR to measure the expression of genes related to HUVECs
According to Figures 8(a-f), after 24 h of LPS action on HUVECs, the expression of GPX4, SLC7A11, PI3K, AKT, and NRF2 genes was dramatically decreased, while the Bax/Bcl-2 gene expression ratio soared notably (P<0.01) when compared to the normal group. The LPS+6-shogaol, LPS+zingerone, and LPS+6-gingerol groups were able to down-regulate the ratio of the expression of Bax/Bcl-2 genes and up-regulate the expression of genes such as GPX4, SLC7A11, PI3K, AKT, and NRF2 (P<0.01) in comparison to the LPS group. The results indicated that three compounds inhibited LPS-induced apoptosis and ferroptosis in HUVECs through the PI3K-AKT-NRF2 signalling pathway.
- Expression of HUVECs related genes and proteins. (a-f) qRT-PCR to detect the expression of HUVECs related genes, (a) The mRNA expression of Bax/Bcl-2. (b) The mRNA expression of GPX4. (c) The mRNA expression of SLC7A11. (d) The mRNA expression of PI3K. (e) The mRNA expression of AKT. (f) The mRNA expression of NRF2. (g-n) Western blot detection of 6-shogaol, zingerone, and 6-gingerol on LPS-induced HUVECs after injury related to protein expression. (g) Bcl-2, Bax, GPX4, SLC7A11 protein expression graph. (h) Bax/Bcl-2 protein relative expression level. (i) GPX4 protein relative expression level. (j) SLC7A11 protein relative expression level. (k) PI3K, P-PI3K, AKT, P-AKT, and NRF2 protein expression graph. (l) P-PI3K protein relative expression level. (m) P-AKT protein relative expression level. (n) NRF2 protein relative expression level.
3.4.7. Western blot to measure the expression of proteins related to HUVECs
The expressions of Bax/Bcl-2, GPX4, and SLC7A11 have been shown in Figures 8(g-j), which showed that compared with the normal group, the Bax/Bcl-2 ratio of HUVECs was significantly increased, and the expressions of GPX4 and SLC7A11 significantly decreased after 24 h of LPS action (P<0.01). Compared with the LPS group, the LPS+6-shogaol, LPS+zingerone, and LPS+6-gingerol groups significantly reduced the Bax/Bcl-2 ratio of HUVECs (P<0.01) and reversed the LPS-induced down-regulation of GPX4 and SLC7A11 genes (P<0.05). The results showed that three compounds were able to inhibit LPS-induced apoptosis and ferroptosis of HUVEs, and the up-regulation of GPX4 and SLC7A11 proteins by 6-shogaol was higher than that of zingerone and 6-gingerol groups.
Figures 8(k-n) displays the pathway proteins’ expression. Not all groups showed a substantial change in the relative expression of PI3K and AKT, while proteins such as P-PI3K, P-AKT, and NRF2 were significantly down-regulated after LPS treatment(P<0.01). The LPS+6-shogaol, LPS+zingerone, and LPS+6-gingerol groups, on the other hand, reversed the LPS-induced downregulation of proteins such as P-PI3K, P-AKT, NRF2, and other proteins downregulation caused by LPS (P<0.01). It indicated that three compounds were able to activate the PI3K-AKT-NRF2 pathway to inhibit ferroptosis to ameliorate LPS-induced HUVECs injury (mechanism as shown in Figure 9), and that the cytoprotective effect of 6-shogaol in the conversion product was slightly stronger than that of the prototype component 6-gingerol, which may be related to the conjugated double bond contained in the structure of 6-shogaol that increases its antioxidant property[22].
- Mechanism of protective effect of 6-shogaol, zingerone and 6-gingerol on HUVECs.
3.5. Discussion
Different processed products of ginger often have different therapeutic effects, which have been proven to be related to changes in the content and structure of chemical components during the processing. At present, it is clear that the chemical components contained in ginger mainly include volatile oils, gingerols, diarylheptanes, and more than 160 other chemical components[23]. Among them, gingerols are the general term for compounds related to the spiciness of ginger and are also the active ingredients in ginger, including gingerol, shogaol, zingerone, etc [24]. 6-gingerol, 6-shogaol, 8-gingerol, and 10-gingerol are the components with high content in dried ginger. Among them, 6-gingerol is the most abundant characteristic component and also the marker component that needs to be tested for quality control of ginger and its processed products in the 2020 edition of the Chinese Pharmacopoeia [25,26]. Gingerol has a polyphenolic hydroxyl structure, which is related to its strong activity and antioxidant properties. However, the polyphenolic hydroxyl structure also has the characteristic of thermal instability. At a certain temperature, gingerol is easily dehydrated and undergoes reverse aldol condensation reaction to produce shogaol and zingerone, which is the main reason for the increase in gingerol content and zingerone production in stir-fried ginger [27].
In terms of traditional efficacy, dried ginger has the effect of promoting blood circulation, improving hemorheological indicators, and is effective in treating symptoms of blood stasis [28]. However, stir-fried ginger weakens its promoting effect on blood circulation and enhances its hemostatic effect, which should be related to the conversion of gingerol components into shogaol and zingerone after heating processing [4]. At present, it is believed that gingerol compounds are the main active ingredients in ginger. In addition to promoting blood circulation, they also have antioxidant, anti-inflammatory, anti-tumor, and other activities, and may have certain potential in endothelial cell protection. To confirm that the conversion of gingerol compounds leads to changes in their activity and further clarify the specific mechanism of their changes in protecting vascular endothelial cells.
The ideal result of TCM processing usually requires a comprehensive judgment based on appearance changes, odor, indicator component content, pharmacological effects, and other indicators. Our research group conducted preliminary studies on the content and antioxidant activity of 6-gingerol in stir-fried ginger at different stir-frying temperatures and times. The results showed that when the sand frying temperature was around 190°C and the time was about 7 min, the various indicators of stir-fried ginger were the most ideal, and the decrease in antioxidant activity was not significant. According to the results of the study on stir-fried ginger, as well as the simulated heating processing experiment of 6-gingerol monomer, it was confirmed that some of the 6-gingerol was converted to 6-shogaol and zingerone after heating. With the extension of oil bath time and the increase of heating temperature, the proportion of 6-gingerol converted to 6-shogaol and zingerone increased.
The results of in vitro antioxidant activity showed that the antioxidant activity of 6-gingerol monomer (including some 6-shogaol and zingerone) was generally weakened after simulated heating processing[29]. In addition to 6-gingerol, ginger contains various gingerols such as 8-gingerol, 10-gingerol, 12-gingerol, etc. It can be inferred that during the heating and processing, they may undergo similar component transformations as 6-gingerol, but this requires further experimental verification. However, it can be confirmed that the changes in the content and structure of multiple components are the reasons that affect and alter the different effects of dried ginger and stir-fried ginger.
In terms of in vitro pharmacological mechanisms, the study focused on observing the protective effects and mechanisms of 6-gingerol and its conversion products, 6-shogaol and zingerone, on vascular endothelial cells. Vascular endothelial cells are important components of human blood vessels, not only as the first barrier for material exchange between cells and blood, but also synthesize a variety of vasoactive substances such as NO, anticoagulant factors, pro-coagulant factors, etc., which are crucial for balancing coagulation and anticoagulation and maintaining the normal functioning of blood, and the abnormalities in their function and structure can cause dysfunctions of the vessel wall such as coagulation, resulting in a series of vascular-related diseases [30,31]. Inflammatory injury and bacterial endotoxin injury are common in vascular endothelial cell injury, and LPS is the main component of bacterial endotoxin [32], which can cause inflammatory response and oxidative stress injury, and it is crucial in the inflammatory damage of vascular endothelial cells [33], therefore, the model of LPS-induced injury of HUVECs was chosen as a model basis of the present experiment. In this paper, the targets and potential pathways of 6-shogaol, zingerone and 6-gingerol acting on the protective effects of VEI were predicted by network pharmacology, and it was found that they were connected to the biological functions of promoting cell proliferation, inhibiting apoptosis, and responding to LPS and inflammation, and mainly acted on the PI3K-AKT pathway to exert protective effects.
Ferroptosis is a type of programmed cell death triggered by the iron-dependent buildup of lipid peroxides. [34], which plays a crucial part in oxidative damage and inflammatory reactions[35,36]. NRF2 is an essential transcription factor that regulates ferroptosis and can influence the expression of several important ferroptosis-related genes, such as SLC7A11 and GPX4 [37,38]. The PI3K-AKT pathway is a regulatory molecule upstream of NRF2, and the regulation of NRF2 reduces oxidative stress damage in cells [39]. When cells are stimulated, oxidants phosphorylate NRF2 by activating the PI3K-AKT pathway, and activated NRF2 enters the nucleus and initiates the expression of antioxidant-related genes, which in turn resist oxidative stress[40]. Research indicates a correlation between oxidative stress, ferroptosis, and the development of VEI [41]. From this, it can be inferred that the protective roles of 6-shogaol, zingerone, and 6-gingerol in safeguarding against VEI might be linked to their influence on the PI3K-AKT-NRF2 signaling pathway, which plays a crucial part in the regulation of ferroptosis.
The outcomes of the in vitro cellular studies partially confirmed the projections made by network pharmacology, demonstrating that the conversion products 6-shogaol, zingerone and the prototype component 6-gingerol were able to reverse LPS-induced alterations in HUVECs morphology as well as to reduce the levels of expression of inflammatory factors, oxidative stress, and ferric iron ions, and to up-regulate PI3K-AKT-NRF2 pathway-related genes and proteins, and reduced HUVECs apoptosis and ferroptosis, indicates that 6-shogaol, zingerone, and 6-gingerol may prevent ferroptosis by activating the PI3K-AKT-NRF2 pathway, thereby reducing LPS-induced oxidative stress damage in HUVEC cells. The above are some interesting findings from this study.
This study focuses on the conversion of 6-gingerol during processing and the effect of its conversion products on the protective mechanism of vascular endothelial cells. However, to comprehensively evaluate the actual bioavailability and in vivo effects of these components, their metabolic processes and pharmacokinetic characteristics are indispensable key elements. Studies have shown that gingerol was metabolized by multiple liver and gastrointestinal UDP-glucosyltransferase (UGT) enzymes, with UGT1A9 and UGT2B7 being the main contributors to the glucuronidation of 6-gingerol, 8-gingerol, and 10-gingerol [42]. The main metabolic form of gingerol in humans and rats is gingerol glucuronide [43,44]. Suzanna M. Zick et al. found that after human volunteers ingested doses of ginger ranging from 100 mg to 2.0 g, no free 6-gingerol, 8-gingerol, 10-gingerol, or 6-shogaol was detected in plasma. These compounds were rapidly absorbed into serum and detected as glucuronide and sulphate conjugates, with glucuronide being the primary metabolite[45]. Other studies have shown that 6-gingerol glucuronide is mainly distributed in the liver and excreted through urine[46,47]. Using whole-animal experiments to study the effects of the processing process on the absorption and metabolism of gingerol components, as well as their protective effects and mechanisms on HUVECs, is a key consideration for the next study.
4. Conclusions
This research is based on the theory of Chinese medicine processing and combines the methods of network pharmacology to systematically investigate the conversion pattern of 6-gingerol during stir-fried ginger processing, as well as the mechanism of LPS-induced oxidative stress damage in HUVECs by the conversion products 6-shogaol, zingerone, and the prototype component 6-gingerol. The main conclusion is that the high temperature during processing promotes the dehydration and reverse aldol condensation reaction of 6-gingerol, producing 6-shogaol and zingerone. Other gingerol components in dried ginger may exhibit similar conversion patterns during processing and frying. The experiment provides experimental evidence from the perspective of changes in chemical composition for the different pharmacological effects of dried ginger and stir-fried ginger and their use in treating different diseases. In addition, 6-gingerol and its conversion products 6-shogaol and zingerone can improve LPS-induced oxidative stress damage in HUVEC by activating the PI3K-AKT-NRF2 pathway to inhibit ferroptosis, and 6-shogaol has the strongest effect, providing ideas for elucidating the pharmacological mechanism of ginger. The limitation of the study is that only in vitro cell models were used to investigate the pharmacological mechanism of 6-gingerol and its conversion products 6-shogaol and zingerone in improving LPS induced oxidative stress damage in HUVEC. The result of cell experiments still differ significantly from complex in vivo situations, so further overall animal experiments are needed.
Acknowledgment
This work was supported by National Key Research and Development Program (2023YFC3504202), Key Project of Natural Science Foundation of Anhui Province Higher Education Institution (2022AH050509&KJ2021A0601), New era education quality project of Anhui Provincial Department of Education (Graduate Education, No. 2023dshwyx021) Construction Project of Famous Traditional Chinese Medicine Practitioners Inheritance Studio in Anhui Province, China, and Anhui Province Traditional Chinese Medicine Inheritance and Innovation Research Project Plan (2024CCCX022).
CRediT authorship contribution statement
Yanquan Han and Hong Yan designed and directed the experiments. Xueqin Wang, Mian He, and Lingling Wang was involved throughout the study, organized the data and wrote the manuscript. Rodney J.Y. Ho provided research methodology suggestions for the paper.
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Declaration of Generative AI and AI-assisted technologies in the writing process
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.
References
- Seeing the unseen of Chinese herbal medicine processing (Paozhi): Advances in new perspectives. Chinese Medicine. 2018;13:4. https://doi.org/10.1186/s13020-018-0163-3
- [Google Scholar]
- Interpreting the efficacy enhancement mechanism of Chinese medicine processing from a biopharmaceutic perspective. Chinese Medicine. 2024;19:14. https://doi.org/10.1186/s13020-024-00887-0
- [Google Scholar]
- Vinegar-processed Curcuma phaeocaulis promotes anti-angiogenic activity and reduces toxicity in zebrafish and rat models. Pharmaceutical Biology. 2021;59:410-417. https://doi.org/10.1080/13880209.2021.1874427
- [Google Scholar]
- Screening for the extracorporeal coagulation activity quality markers (Q-markers) of dried and stir fried ginger. Arabian Journal of Chemistry. 2022;15:104151. https://doi.org/10.1016/j.arabjc.2022.104151
- [Google Scholar]
- Zingiber officinale: A systematic review of botany, phytochemistry and pharmacology of gut microbiota-related gastrointestinal benefits. The American Journal of Chinese Medicine. 2022;50:1007-1042. https://doi.org/10.1142/S0192415X22500410
- [Google Scholar]
- Comparison of fresh, dried and stir-frying gingers in decoction with blood stasis syndrome in rats based on a GC-TOF/MS metabolomics approach. Journal of Pharmaceutical and Biomedical Analysis. 2016;129:339-349. https://doi.org/10.1016/j.jpba.2016.07.021
- [Google Scholar]
- Pharmacological activity and clinical application analysis of traditional Chinese medicine ginger from the perspective of one source and multiple substances. Chinese Medicine. 2024;19:97. https://doi.org/10.1186/s13020-024-00969-z
- [Google Scholar]
- Alternative processing technology for the preparation of carbonized Zingiberis Rhizoma by stir-frying with sand. Pharmaceutical Biology. 2020;58:131-137. https://doi.org/10.1080/13880209.2019.1711431
- [Google Scholar]
- 6-Gingerol attenuates subarachnoid hemorrhage-induced early brain injury via GBP2/PI3K/AKT pathway in the rat model. Frontiers in Pharmacology. 2022;13:882121. https://doi.org/10.3389/fphar.2022.882121
- [Google Scholar]
- Mechanism exploration of 6-Gingerol in the treatment of atherosclerosis based on network pharmacology, molecular docking and experimental validation. Phytomedicine : International Journal of Phytotherapy and Phytopharmacology. 2023;115:154835. https://doi.org/10.1016/j.phymed.2023.154835
- [Google Scholar]
- Anticancer effects of 6-gingerol through downregulating iron transport and PD-L1 Expression in non-small cell lung cancer cells. Cells. 2023;12:2628. https://doi.org/10.3390/cells12222628
- [Google Scholar]
- Gingerol nanoparticles attenuate complete Freund adjuvant-induced arthritis in rats via targeting the RANKL/OPG signaling pathway. Inflammopharmacology. 2024;32:3311-3326. https://doi.org/10.1007/s10787-024-01537-5
- [Google Scholar]
- Environmental safe disposal of cement kiln dust for the production of geopolymers. Egyptian Journal of Chemistry. 2021;0:0. https://doi.org/10.21608/ejchem.2021.89060.4276
- [Google Scholar]
- Sustainable development goals for industry, innovation, and infrastructure: Demolition waste incorporated with nanoplastic waste enhanced the physicomechanical properties of white cement paste composites. Applied Nanoscience 2023:1-16. https://doi.org/10.1007/s13204-023-02766-w
- [Google Scholar]
- A comprehensive study on the fire resistance properties of ultra-fine ceramic waste-filled high alkaline white cement paste composites for progressing towards sustainability. Scientific Reports. 2023;13:22097. https://doi.org/10.1038/s41598-023-49229-4
- [Google Scholar]
- Vascular endothelial cell biology: An update. International Journal of Molecular Sciences. 2019;20:4411. https://doi.org/10.3390/ijms20184411
- [Google Scholar]
- Role of crotoxin in coagulation: Novel insights into anticoagulant mechanisms and impairment of inflammation-induced coagulation. The Journal of Venomous Animals and Toxins Including Tropical Diseases. 2020;26:e20200076. https://doi.org/10.1590/1678-9199-JVATITD-2020-0076
- [Google Scholar]
- Blocking the REDD1/TXNIP axis ameliorates LPS-induced vascular endothelial cell injury through repressing oxidative stress and apoptosis. American Journal of Physiology. Cell Physiology. 2019;316:C104-C110. https://doi.org/10.1152/ajpcell.00313.2018
- [Google Scholar]
- Zingiber officinale roscoe rhizome extract exerts senomorphic and anti-inflammatory activities on human endothelial cells. Biology. 2023;12:438. https://doi.org/10.3390/biology12030438
- [Google Scholar]
- miR-125b-5p in adipose derived stem cells exosome alleviates pulmonary microvascular endothelial cells ferroptosis via Keap1/Nrf2/GPX4 in sepsis lung injury. Redox Biology. 2023;62:102655. https://doi.org/10.1016/j.redox.2023.102655
- [Google Scholar]
- Natural Product-Based Screening for Lead Compounds Targeting SARS CoV-2 Mpro. Pharmaceuticals. 2023;16:767. https://doi.org/10.3390/ph16050767
- [Google Scholar]
- Conversion of 6-gingerol to 6-shogaol in ginger (Zingiber officinale) pulp and peel during subcritical water extraction. Food Chemistry. 2019;270:149-155. https://doi.org/10.1016/j.foodchem.2018.07.078
- [Google Scholar]
- Ginger (Zingiber officinale Rosc.) and its bioactive components are potential resources for health beneficial agents. Phytotherapy Research : PTR. 2021;35:711-742. https://doi.org/10.1002/ptr.6858
- [Google Scholar]
- Preparation, pungency and bioactivity of gingerols from ginger (Zingiber officinale Roscoe): A review. Critical Reviews in Food Science and Nutrition. 2024;64:2708-2733. https://doi.org/10.1080/10408398.2022.2124951
- [Google Scholar]
- Gingerols and shogaols: Important nutraceutical principles from ginger. Phytochemistry. 2015;117:554-568. https://doi.org/10.1016/j.phytochem.2015.07.012
- [Google Scholar]
- Formation of 6-, 8- and 10-shogaol in ginger through application of different drying methods: Altered antioxidant and antimicrobial activity. Molecules (Basel, Switzerland). 2018;23:1646. https://doi.org/10.3390/molecules23071646
- [Google Scholar]
- Impact of drying and extractions processes on the recovery of gingerols and shogaols, the main bioactive compounds of ginger. Food Research International (Ottawa, Ont.). 2022;154:111043. https://doi.org/10.1016/j.foodres.2022.111043
- [Google Scholar]
- Metabolomics study of dried ginger extract on serum and urine in blood stasis rats based on UPLC-Q-TOF/MS. Food Science & Nutrition. 2020;8:6401-6414. https://doi.org/10.1002/fsn3.1929
- [Google Scholar]
- Study on the transformation rule of 6-gingerol and its antioxidant activity during the processing of ginger. Natural Product Research and Development. 2022;34:1352-1360. https://doi.org/10.16333/j.1001-6880.2022.8.011
- [Google Scholar]
- By modulating miR-525-5p/Bax axis, LINC00659 promotes vascular endothelial cell apoptosis. Immunity, Inflammation and Disease. 2023;11:e764. https://doi.org/10.1002/iid3.764
- [Google Scholar]
- Ponatinib induces a procoagulant phenotype in human coronary endothelial cells via inducing apoptosis. Pharmaceutics. 2024;16:559. https://doi.org/10.3390/pharmaceutics16040559
- [Google Scholar]
- Protective effect of berberine against LPS-induced endothelial cell injury via the JNK signaling pathway and autophagic mechanisms. Bioengineered. 2021;12:1324-1337. https://doi.org/10.1080/21655979.2021.1915671
- [Google Scholar]
- Capmatinib suppresses LPS-induced interaction between HUVECs and THP-1 monocytes through suppression of inflammatory responses. Biomedical Journal. 2023;46:100534. https://doi.org/10.1016/j.bj.2022.04.005
- [Google Scholar]
- The mechanisms of ferroptosis and its role in atherosclerosis. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie. 2024;171:116112. https://doi.org/10.1016/j.biopha.2023.116112
- [Google Scholar]
- The emerging role of ferroptosis in inflammation. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie. 2020;127:110108. https://doi.org/10.1016/j.biopha.2020.110108
- [Google Scholar]
- Ferroptosis: Emerging roles in lung cancer and potential implications in biological compounds. Frontiers in Pharmacology. 2024;15:1374182. https://doi.org/10.3389/fphar.2024.1374182
- [Google Scholar]
- Kaempferol Ameliorates oxygen-glucose deprivation/reoxygenation-induced neuronal ferroptosis by activating Nrf2/SLC7A11/GPX4 Axis. Biomolecules. 2021;11:923. https://doi.org/10.3390/biom11070923
- [Google Scholar]
- Edaravone ameliorates cerebral ischemia-reperfusion injury by downregulating ferroptosis via the Nrf2/FPN Pathway in Rats. Biological & Pharmaceutical Bulletin. 2022;45:1269-1275. https://doi.org/10.1248/bpb.b22-00186
- [Google Scholar]
- Dapagliflozin attenuates cholesterol overloading-induced injury in mice hepatocytes with type 2 diabetes mellitus (T2DM) via eliminating oxidative damages. Cell Cycle (Georgetown, Tex.). 2022;21:641-654. https://doi.org/10.1080/15384101.2022.2031429
- [Google Scholar]
- Melatonin alleviates oxidative stress-induced injury to nucleus pulposus-derived mesenchymal stem cells through activating PI3K/Akt pathway. Journal of Orthopaedic Translation. 2023;43:66-84. https://doi.org/10.1016/j.jot.2023.10.002
- [Google Scholar]
- Xanthorrhizol, a potential anticancer agent, from Curcuma xanthorrhiza Roxb. Phytomedicine : International Journal of Phytotherapy and Phytopharmacology. 2022;105:154359. https://doi.org/10.1016/j.phymed.2022.154359
- [Google Scholar]
- Regioselective glucuronidation of gingerols by human liver microsomes and expressed UDP-glucuronosyltransferase enzymes: Reaction kinetics and activity correlation analyses for UGT1A9 and UGT2B7. The Journal of Pharmacy and Pharmacology. 2015;67:583-596. https://doi.org/10.1111/jphp.12351
- [Google Scholar]
- Examination of the pharmacokinetics of active ingredients of ginger in humans. The AAPS journal. 2011;13:417-426. https://doi.org/10.1208/s12248-011-9286-5
- [Google Scholar]
- A novel method for the quantitation of gingerol glucuronides in human plasma or urine based on stable isotope dilution assays. Journal of Chromatography. B, Analytical Technologies in the Biomedical and Life Sciences. 2016;1036-1037:1-9. https://doi.org/10.1016/j.jchromb.2016.09.033
- [Google Scholar]
- Pharmacokinetics of 6-gingerol, 8-gingerol, 10-gingerol, and 6-shogaol and conjugate metabolites in healthy human subjects. Cancer Epidemiology, Biomarkers & Prevention : A Publication of the American Association for Cancer Research, Cosponsored by the American Society of Preventive Oncology. 2008;17:1930-1936. https://doi.org/10.1158/1055-9965.EPI-07-2934
- [Google Scholar]
- Plasma pharmacokinetics, tissue distribution and excretion study of 6-gingerol in rat by liquid chromatography–electrospray ionization time-of-flight mass spectrometry. Journal of Pharmaceutical and Biomedical Analysis. 2009;49:1070-1074. https://doi.org/10.1016/j.jpba.2009.01.020
- [Google Scholar]
- Unraveling the interconversion pharmacokinetics and oral bioavailability of the major ginger constituents: [6]-gingerol, [6]-shogaol, and zingerone after single-dose administration in rats. Frontiers in Pharmacology. 2024;15:1391019. https://doi.org/10.3389/fphar.2024.1391019
- [Google Scholar]