Translate this page into:
Synthesis and evaluation of thiadiazole thioether analogs for hedgehog signaling pathway inhibition and malignant biological behavior against medulloblastoma cells
*Corresponding author: E-mail address: chiyusun@symc.edu.cn (C. Sun)
-
Received: ,
Accepted: ,
Abstract
Medulloblastoma (MB), a prevalent pediatric malignant neoplasm that arises in the cerebellum. It demonstrates a pathogenesis fundamentally linked to dysregulated Hedgehog (HH) pathway activation. Smoothened (SMO), a core component of the Hh pathway, undergoes abnormal activation that triggers hypertranscription of the downstream target gene GLI1, resulting in sustained activation of the HH pathway and subsequently accelerating tumor cell proliferation and invasion. Unfortunately, vismodegib, approved by the FDA, has encountered the challenge of drug resistance in MB treatment. Therefore, developing novel HH pathway inhibitors to precisely block this abnormal signaling conduction has become a critical issue that the scientific community urgently needs to address, holding great significance for the innovation of treatment strategies for MB. This study is dedicated to designing, synthesizing, and evaluating a series of HH pathway inhibitors targeting SMO, based on the thiadiazole thioether scaffold. Through rigorous GLI luciferase reporter gene assay screening, we have successfully identified a promising analog, 2-((2-methoxyphenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (WMC03). This compound exhibits a competitive action similar to cyclopamine at the binding site of the SMO protein, reducing cilium formation by binding to SMO, and thereby inhibiting the activation of the HH pathway. Molecular modeling approaches have provided deeper insights into the interaction mechanism between WMC03 and the SMO protein, shedding light on the collaborative contributions of hydrogen bonding, hydrophobic interactions, and electrostatic forces. Notably, WMC03 demonstrated a robust ability to suppress GLI1 expression, exerting its inhibitory effects at both the transcriptional and translational stages. This suppression subsequently led to the effective inhibition of Daoy cell proliferation and migration, ultimately triggering apoptosis in these cells. These findings not only emphasize the remarkable efficacy of WMC03 in MB cells but also provide new ideas and approaches for the development of efficient and specific Hh pathway inhibitors for the clinical treatment of MB.
Keywords
Hedgehog signaling pathway
Medulloblastoma
Proliferation
Synthesis

1. Introduction
Medulloblastoma (MB) holds the distinction of being the most frequently occurring malignant brain tumor in the pediatric population, with its origins tracing back to the primitive neuroectodermal cells located in the cerebellum. This type of tumor, derived from embryonic cells of the cerebellum, accounts for 20% of all childhood brain tumors [1,2]. Affected children typically present with subtle neurological symptoms such as headaches, vomiting, lethargy, and coordination problems in the lower extremities due to cerebellar involvement. More severe symptoms include Parinaud syndrome, facial weakness, and hearing loss, which may persist for 3 months or longer before diagnosis [3].
In terms of treatment, surgery is the primary approach aimed at removing as much tumor tissue as possible. Postoperatively, radiation therapy and/or chemotherapy are commonly used to treat the brain and spine. Traditional chemotherapeutic drugs include cisplatin, vincristine, carboplatin, cyclophosphamide, and lomustine [4-8]. Although these aggressive treatment modalities can control 70-80% of pediatric MB cases, affected children often experience serious side effects, including endocrine dysfunction, stunted growth, neurocognitive impairments, secondary malignancies, hearing loss, and cardiopulmonary issues [9]. To achieve precision medicine, MB patients are classified into four subtypes: WNT, Hedgehog (HH), Group 3, and Group 4 [10-12]. Based on this classification, researchers are developing targeted therapies, which have become a core strategy. Among these, the MB subtype with abnormal HH pathway activity has been extensively studied and is prevalent in both infants and adults. Research teams are exploring small-molecule inhibitors of the HH pathway, some of which have already been approved for clinical use, bringing new hope for MB treatment and indicating a future with more precise and less toxic therapeutic options.
The HH signaling pathway is of critical importance in both embryonic development and the process of tumorigenesis. Insufficient activation of this pathway can lead to embryonic developmental defects and abnormal tissue function. In contrast, overactivation is closely associated with diseases such as MB [13,14], basal cell carcinoma (BCC) [15], pancreatic cancer [16], acute myeloid leukemia (AML) [17], as well as gastric and colorectal cancer [18,19]. The conventional activation mechanism of the HH signaling pathway commences when HH ligands (for instance, Sonic hedgehog, SHH) bind to the PTCH receptor situated on cilia, which relieves the inhibition of PTCH on the Smoothened (SMO) protein, allowing SMO to be activated and translocate to the cilia tip. Following SMO activation, the Sufu-GLI complex dissociates, freeing GLI-FL to translocate into the nucleus, where it is modified into transcriptionally active GLIA. GLIA then drives the expression of HH-responsive genes, controlling vital processes like cell growth, proliferation, and differentiation [20,21].
SMO constitutes a pivotal component of the HH signaling pathway, undertaking the crucial task of signal transduction. However, research has demonstrated that dysregulated SMO activation or genetic mutations in SMO are strongly linked to the pathogenesis of cancers, including BCC and MB [22,23]. In these cancers, abnormal activation of SMO promotes abnormal cell proliferation, thereby driving tumor development. Up until the present moment, the U.S. Food and Drug Administration (FDA) has authorized three SMO inhibitors for clinical use: vismodegib (1), sonidegib (2), and glasdegib (3). These drugs are employed in managing BCC and AML (Figure 1) [24-26]. Additionally, several other substances, such as taladegib, vitamin D3, itraconazole, and LEQ506, are presently undergoing clinical trials across different phases [27-30]. It is noteworthy that a clinical trial aimed at exploring the treatment of recurrent or refractory HH-dependent MB patients with vismodegib in combination with Temozolomide (TMZ) was forced to terminate due to the failure to achieve the expected results in the first stage of Phase II [31].

- The launched inhibitors of the HH signaling pathway. (1) Vismodegib, (2) sonidegib, and (3) glasdegib.
Thiadiazoles represent a class of aromatic five-membered rings composed of carbon, sulfur, and two nitrogen atoms. The sulfur’s lone pair electrons, along with the ring’s double bonds, contribute to their stable, conjugated structure [32]. The thiadiazole scaffold has emerged as a pharmacologically privileged structure, demonstrating potent biological effects across multiple disease domains - from parasitic infections and diabetes to oxidative damage and malignancies [33-36].In particular, studies have shown that thiadiazole derivatives exhibit promising anticancer activity against a variety of cancer cell lines, including liver cancer, breast cancer, colon cancer, non-small cell lung cancer, and epidermal carcinoma [37-40]. Lu W.F. et al. previously reported the strategy and detailed procedure for virtual screening and identifying C794-1677 (4, Figure 2) from the commercially available ChemDiv database. It is worth noting that compound 4, consisting of a thiadiazole pharmacophore, exhibited excellent HH inhibition activity with an IC50 value of 47 nM in a GLI luciferase (GLI-LUC) reporter assay [41]. In addition, thioether analogs, such as fabomotizole, ranitidine, and carbocisteine, exhibited desirable metabolic stability [42-44]. Notably, benzoimidazole thioethers related to the HH signaling pathway were identified, among which compound 5 showed regular metabolism and anti-HH activity in a low micromolar concentration range [45]. Here, a series of thiadiazole thioether derivatives were fabricated using the scaffold hop strategy and bioisostere principle, with the expectation of creating strong affinity with the target receptor that regulates HH signaling. Furthermore, they were prepared simply and characterized by nuclear magnetic resonance (1H NMR & 13C NMR) and high-resolution mass spectrometry (HRMS) spectra. In the study of the molecular mechanism, HH pathway inhibition, SMO binding action, and cilium biogenesis impairment by the target compounds were ascertained through GLU-LUC reporter assays, fluorescence molecular probes, and immunofluorescence analyses. The interaction between thiadiazole thioether derivatives and the SMO receptor was predicted by molecular docking. In the regulation of HH pathway target genes, GLI mRNA levels were monitored using reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) technology. Subsequently, a detailed investigation of the malignant biological behavior of MB Daoy cells was conducted, including proliferation, migration, and invasion assays in the presence of the target compounds, using MTT, wound healing, and transwell assays. Furthermore, their apoptosis rates against Daoy cells were observed using flow cytometry. The thiadiazole thioether analogs exhibited potential as targeted drugs for the treatment of HH-driven MB.

- Design of the thiadiazole thioether analogs.
2. Materials and Methods
2.1. General
All reagents used were analytical grade and obtained from commercial suppliers. The thin-layer chromatography technique was employed to confirm the organic reactions involved in drug synthesis. Melting points were determined using the WRS Melting Points apparatus (KEYI, Beijing, China). The NMR spectra were acquired with a Bruker Avance 400 spectrometer (Bruker Bioscience, MA, USA). HRMS were obtained on an LCMS IT-TOF spectrometer (SHIMADZU, Shanghai, China).
2.2. Synthesis
2.2.1. Approach for preparing 5-(pyridin-4-yl)-1,3,4-thiadiazole-2-thiol (7)
In a 1-L round-bottom flask, 29.41 g (0.215 mol) of isoniazid, 38.07 g (0.43 mol) of CS2, and 28.05 g (0.43 mol) of KOH were dissolved in 400 mL of absolute ethanol. The mixture was stirred for 20 h, and the precipitate was isolated through filtration and rinsed three times using 300 mL of dichloromethane. The filtered solid was then dried and pulverized, resulting in the desired compound 6 (46.29 g, 86%) as a pale-yellow powder. The prepared substance was utilized directly without undergoing additional purification or characterization
Compound 6 (46.29 g, 0.185 mol) was added in batches to 200 mL of concentrated sulfuric acid in a 500 mL round-bottom flask. The solution was agitated mechanically at 0°C for 4 h in an ice bath. Then, the solution was adjusted to a pH of 10 with 10 mol/L NaOH solution, and the color of the solution gradually changed from pale yellow to red. The reaction solution was then extracted twice with an equivalent volume of ethyl acetate. The organic phase was discarded, and the aqueous layer was acidified with 5 mol/L HCl. The precipitates were filtered, washed with a hot ethanol-water mixture, dried under vacuum, and finally yielded the desired compound 7 (19.1 g, 53%) as a yellow powder. The 1H NMR spectrum (400 MHz, DMSO-d6) showed δ 8.75 (d, J = 6.2 Hz, 2H) and 7.72 (d, J = 6.2 Hz, 2H).
2.2.2. Approach for preparing 2-((4-chlorophenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (8)
Compound 7 (5.2 mmol, 1 g), 4-chloroiodobenzene (7.8 mmol, 2.848 g), copper(I) iodide (0.26 mmol, 48 mg), 1,10-phenanthroline (0.52 mmol, 92 mg), and potassium carbonate (6.8 mmol, 0.938 g) were dissolved in 10 mL of N, N-dimethylformamide and stirred for 10 h at 120°C. Then, the mixture was poured into ice water and allowed to stand overnight. The precipitates were collected by filtration and dried to give 0.459 g of a brick-red crude product. The residue was subjected to column chromatography on silica gel, eluted using a petroleum ether and ethyl acetate mixture (8:1, v/v), to furnish compound 8 as a pale yellow powder. (415 mg, 26%). Melting point: 104-105°C. 1H NMR (400 MHz, DMSO-d6) δ 8.77 – 8.70 (m, 2H), 7.88 – 7.84 (m, 2H), 7.84 – 7.79 (m, 2H), 7.67 – 7.61 (m, 2H). 13C NMR (101 MHz, DMSO-d6) δ 169.66, 167.15, 151.36 (2C), 136.42, 136.36 (3C), 130.97 (2C), 129.20, 121.77 (2C). HRMS (ESI) m/z calcd for C13H9ClN3S2 [M+H]+ 305.9926, found 305.9930.
2.2.3. Approach for preparing 2-((4-fluorophenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (9)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 4-fluoroaniline, yielding 29% of the desired product. m.p. 86-87°C. 1H NMR (400 MHz, DMSO-d6) δ 8.75 – 8.69 (m, 2H), 7.89 (ddt, J = 8.5, 5.3, 2.7 Hz, 2H), 7.86 – 7.81 (m, 2H), 7.48 – 7.40 (m, 2H). 13C NMR (101 MHz, DMSO-d6) δ 170.88, 166.79, 165.36, 151.34(2C), 137.76(2C), 136.44, 125.79, 121.72(2C), 118.33(2C). HRMS(ESI) m/z calcd for C13H9FN3S2 [M+H]+ 290.0222, found 290.0226.
2.2.4. Approach for preparing methyl 4-((5-(pyridin-4-yl)-1,3,4-thiadiazol-2-yl)thio)benzoate (10)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and methyl 4-aminobenzoate, yielding 31% of the desired product. m.p. 111-112°C. 1H NMR (400 MHz, DMSO-d6) δ 8.75 (dd, J = 4.6, 1.4 Hz, 2H), 8.07 – 8.03 (m, 2H), 7.89 – 7.83 (m, 4H), 3.89 (s, 3H). 13C NMR (101 MHz, DMSO-d6) δ 168.10, 167.08, 165.93, 151.40(2C), 136.80, 136.37, 133.15(2C), 131.17(2C), 131.14, 121.84(2C), 52.99. HRMS(ESI) m/z calcd for C15H12N3O2S2 [M+H]+ 330.0371, found 330.0381.
2.2.5. Approach for preparing methyl 2-((2-chlorophenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (11)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 2-chloroaniline, yielding 26% of the desired product. m.p. 102-103°C. 1H NMR (400 MHz, DMSO-d6) δ 8.73 (d, J = 5.9 Hz, 2H), 7.95 – 7.90 (m, 2H), 7.87 – 7.83 (m, 2H), 7.55 (d, J = 8.0 Hz, 2H). 13C NMR (101 MHz, DMSO-d6) δ 169.01, 167.34, 151.34(2C), 150.28, 136.62(3C), 136.39, 129.44, 123.09(2C), 121.75(2C). HRMS(ESI) m/z calcd for C13H9ClN3S2 [M+H]+ 305.9926, found 305.9938.
2.2.6. Approach for preparing 2-((2,4-difluorophenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (12)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 2,4-difluoroaniline, yielding 28% of the desired product. m.p. 110-111°C. 1H NMR (400 MHz, DMSO-d6) δ 8.74 (d, J = 5.8 Hz, 2H), 7.85 (dd, J = 4.6, 1.5 Hz, 2H), 7.78 (ddd, J = 15.1, 8.4, 6.6 Hz, 1H), 7.44 – 7.37 (m, 2H). 13C NMR (101 MHz, DMSO-d6) δ 167.55, 166.55, 163.93(2C), 151.34(2C), 136.34, 135.39, 121.83(2C), 114.03(2C), 105.90. HRMS(ESI) m/z calcd for C13H8F2N3S2 [M+H]+ 308.0128, found 308.0132.
2.2.7. Approach for preparing 2-((3-chloro-2-fluorophenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (13)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and methyl 3-chloro-2-fluoroaniline, yielding 21% of the desired product. m.p. 108-109°C. 1H NMR (400 MHz, DMSO-d6) δ 8.77 – 8.71 (m, 2H), 7.90 – 7.79 (m, 4H), 7.41 (td, J = 8.0, 1.0 Hz, 1H). 13C NMR (101 MHz, DMSO-d6) δ 167.78, 166.74, 158.63, 156.15, 151.36(2C), 136.34, 135.75, 134.38, 127.27, 121.82(2C), 119.13. HRMS(ESI) m/z calcd for C13H8ClFN3S2 [M+H]+ 323.9832, found 323.9836.
2.2.8. Approach for preparing 2-((3,5-dichlorophenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (14)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 3,5-dichloroaniline, yielding 33% of the desired product. m.p. 120-121°C. 1H NMR (400 MHz, DMSO-d6) δ 8.76 (d, J = 6.0 Hz, 2H), 7.92 – 7.86 (m, 4H), 7.83 (t, J = 1.8 Hz, 1H). 13C NMR (101 MHz, DMSO-d6) δ 168.04, 166.98, 151.41(2C), 136.39, 135.72, 134.15, 131.95(2C), 130.51(2C), 121.87(2C). HRMS(ESI) m/z calcd for C13H8Cl2N3S2 [M+H]+ 339.9537, found 339.9542.
2.2.9. Approach for preparing 2-((2,4-dimethylphenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (15)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 2,4-dimethylaniline, yielding 22% of the desired product. m.p. 113-114°C. 1H NMR (400 MHz, DMSO-d6) δ 8.75 (d, J = 5.3 Hz, 2H), 8.04 (dd, J = 8.7, 6.0 Hz, 1H), 7.89 – 7.85 (m, 2H), 7.83 (dd, J = 8.7, 2.8 Hz, 1H), 7.46 (td, J = 8.5, 2.8 Hz, 1H). 13C NMR (101 MHz, DMSO-d6) δ 168.18, 167.33, 165.30, 162.78, 151.35(2C), 139.44, 136.35, 125.12, 121.77(2C), 119.33, 117.11. HRMS(ESI) m/z calcd for C13H8ClFN3S2 [M+H]+ 323.9832, found 323.9840.
2.2.10. Approach for preparing 2-((2,6-difluorophenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (16)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 2,6-difluoroaniline, yielding 25% of the desired product. m.p. 84-85°C. 1H NMR (400 MHz, DMSO-d6) δ 8.74 (d, J = 5.8 Hz, 2H), 7.85 (dd, J = 4.6, 1.5 Hz, 2H), 7.78 (ddd, J = 15.1, 8.4, 6.6 Hz, 1H), 7.44 – 7.37 (m, 2H). 13C NMR (101 MHz, DMSO-d6) δ 167.55, 166.55, 163.93(2C), 151.34(2C), 136.34, 135.39, 121.83(2C), 114.03(2C), 105.90. HRMS(ESI) m/z calcd for C13H8F2N3S2 [M+H]+ 308.0128, found 308.0125.
2.2.11. Approach for preparing 2-((3-fluorophenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (17)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 3-fluoroaniline, yielding 34% of the desired product. m.p. 79-80°C. 1H NMR (400 MHz, DMSO-d6) δ 8.75 – 8.72 (m, 2H), 7.87 – 7.84 (m, 2H), 7.74 – 7.68 (m, 1H), 7.61 (tt, J = 3.8, 1.9 Hz, 2H), 7.47 – 7.41 (m, 1H). 13C NMR (101 MHz, DMSO-d6) δ 168.72, 167.44, 161.61, 151.35(2C), 136.40, 132.74, 132.27, 130.31, 121.78(2C), 121.01, 118.31. HRMS(ESI) m/z calcd for C13H8FN3S2 [M+H]+ 290.0222, found 290.0226.
2.2.12. Approach for preparing 2-(pyridin-4-yl)-5-((3-(trifluoromethyl)phenyl)thio)-1,3,4-thiadiazole (18)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 3-(trifluoromethyl)aniline, yielding 32% of the desired product. m.p. 101-102°C. 1H NMR (400 MHz, DMSO-d6) δ 8.75 (d, J = 5.1 Hz, 2H), 8.18 (s, 1H), 8.09 (d, J = 7.8 Hz, 1H), 7.95 (d, J = 7.9 Hz, 1H), 7.87 (d, J = 6.1 Hz, 2H), 7.80 (t, J = 7.9 Hz, 1H). 13C NMR (101 MHz, DMSO-d6) δ 168.15, 167.59, 151.38(2C), 138.28, 136.39, 132.02, 131.95, 131.41, 131.09, 130.61, 127.69, 121.82(2C). HRMS(ESI) m/z calcd for C14H9F3N3S2 [M+H]+ 340.0190, found 340.0197.
2.2.13. Approach for preparing 2-(pyridin-4-yl)-5-((3-(trifluoromethoxy)phenyl)thio)-1,3,4-thiadiazole (19)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 3-(trifluoromethoxy)aniline, yielding 35% of the desired product. m.p. 64-65°C. 1H NMR (400 MHz, DMSO-d6) δ 8.77 (s, 2H), 7.90 – 7.81 (m, 4H), 7.72 (t, J = 8.0 Hz, 1H), 7.62 – 7.58 (m, 1H). 13C NMR (101 MHz, DMSO-d6) δ 168.08, 167.59, 151.35(2C), 149.41, 136.37, 133.05, 132.62, 126.34, 123.46, 121.78(2C), 121.73, 119.17. HRMS(ESI) m/z calcd for C14H9F3N3OS2 [M+H]+ 356.0139, found 356.0136.
2.2.14. Approach for preparing 2-(pyridin-4-yl)-5-((4-(trifluoromethoxy)phenyl)thio)-1,3,4-thiadiazole (20)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 4-(trifluoromethoxy)aniline, yielding 41% of the desired product. m.p. 70-71°C. 1H NMR (400 MHz, DMSO-d6) δ 8.73 (d, J = 5.9 Hz, 2H), 7.95 – 7.90 (m, 2H), 7.87 – 7.83 (m, 2H), 7.55 (d, J = 8.0 Hz, 2H). 13C NMR (101 MHz, DMSO-d6) δ 169.01, 167.34, 151.34(2C), 150.28, 136.62(3C), 136.39, 129.44, 123.09(2C), 121.75(2C). HRMS(ESI) m/z calcd for C14H9F3N3OS2 [M+H]+ 356.0139, found 356.0148.
2.2.15. Approach for preparing 2-((4-ethoxyphenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (21)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 4-ethoxyaniline, yielding 49% of the desired product. m.p. 115-116°C. 1H NMR (400 MHz, DMSO-d6) δ 8.71 (d, J = 5.9 Hz, 2H), 7.84 – 7.78 (m, 2H), 7.77 – 7.69 (m, 2H), 7.16 – 7.08 (m, 2H), 4.11 (q, J = 7.0 Hz, 2H), 1.37 (t, J = 7.0 Hz, 3H). 13C NMR (101 MHz, DMSO-d6) δ 173.29, 166.20, 161.33, 151.31(2C), 137.25(2C), 136.53, 121.67(2C), 119.99, 117.01(2C), 64.12, 15.02. HRMS(ESI) m/z calcd for C15H14N3OS2 [M+H]+ 316.0578, found 316.0583.
2.2.16. Approach for preparing 2-((4-(tert-butyl)phenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (22)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 4-(tert-butyl)aniline, yielding 45% of the desired product. m.p. 110-111°C. 1H NMR (400 MHz, DMSO-d6) δ 8.72 (d, J = 5.9 Hz, 2H), 7.83 (dd, J = 4.7, 1.4 Hz, 2H), 7.71 (d, J = 8.4 Hz, 2H), 7.58 (d, J = 8.4 Hz, 2H), 1.32 (s, 9H). 13C NMR (101 MHz, DMSO-d6) δ 171.01, 166.71, 154.28, 151.34(2C), 136.49, 134.50(2C), 127.95(2C), 126.76, 121.76(2C), 35.19, 31.38(3C). HRMS(ESI) m/z calcd for C17H18N3S2 [M+H]+ 328.0942, found 328.0943.
2.2.17. Approach for preparing 2-((2-methoxyphenyl)thio)-5-(pyridin-4-yl)-1,3,4-thiadiazole (23)
Using a method analogous to that employed for synthesizing compound 8, a faint yellow powder was obtained from compound 7 and 2-methoxyaniline, yielding 46% of the desired product. m.p. 100-101°C. 1H NMR (400 MHz, DMSO-d6) δ 8.75 – 8.69 (m, 2H), 7.86 – 7.81 (m, 2H), 7.72 (dd, J = 7.7, 1.7 Hz, 1H), 7.62 (ddd, J = 8.9, 7.5, 1.7 Hz, 1H), 7.28 (dd, J = 8.4, 1.2 Hz, 1H), 7.11 (td, J = 7.6, 1.2 Hz, 1H), 3.87 (s, 3H). 13C NMR (101 MHz, DMSO-d6) δ 170.63, 166.53, 159.43, 151.31(2C), 136.55, 136.51, 133.86, 122.29, 121.72(2C), 117.29, 113.43, 56.72. HRMS(ESI) m/z calcd for C14H12N3OS2 [M+H]+ 302.0422, found 302.0425.
2.3. GLI Luciferase reporter assay
NIH3T3 cells were maintained in Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, 100 μg/mL streptomycin, and 2 mM glutamine. Cells were then seeded into 96-well plates and allowed to adhere overnight. Subsequently, the cells underwent specific treatments for 48 h. Using the Promega dual-luciferase reporter gene assay system on a GloMax 20/20 luminometer, the fluorescence enzyme activities of firefly luciferase and Renilla luciferase were measured in cell lysates, following the manufacturer’s instructions. Subsequently, the activity of firefly luciferase was normalized to that of Renilla luciferase to evaluate the effects of various treatments on cellular gene expression.
2.4. Fluorescence binding assays
HEK-293T cells were successfully transfected with the SMO plasmid, generously provided by China’s GenePharma company, and the transfection efficiency was confirmed via Western blot analysis. Subsequently, in a cell culture incubator, each well of a 96-well plate was treated with 100µl of a 100µg/ml poly-L-lysine solution for 2 h, followed by removal of the solution. After that, 2×10⁴ cells were seeded into each well and allowed to culture under appropriate conditions for 24 h. Following the completion of culture, the cells underwent fixation with 4% paraformaldehyde and were stained with DAPI. Subsequently, 100 nM of BODIPY-Cyclopamine (procured from Biovision, USA) was added to each well, together with the test compounds WMC03 and Vismodegib (both obtained from Bidepharm, China). These were then incubated together for 2 h. Ultimately, the intensity of green fluorescence emitted by the cells was assessed using a Zeiss Axio Observer fluorescence microscope, which was manufactured in Germany.
2.5. Immunofluorescence test
In this study, we utilized immunofluorescence experiments to explore the expression and localization of SMO protein and acetylated α-tubulin in NIH3T3 cells. The experiment comprised three main parts: cell transfection, cell seeding on coverslips with drug treatment using WMC03, and immunofluorescence staining. Firstly, the SMO plasmid was transfected into NIH 3T3 cells using LipofectamineTM3000 reagent to obtain cells overexpressing the SMO protein. Subsequently, the cells were seeded onto coverslips and treated with drugs using WMC03. Finally, through immunofluorescence staining, GFP primary antibody and acetylated α-tubulin primary antibody (of different species origins) were sequentially added. The cells were then observed and photographed under a fluorescence microscope (Axio Observer, Carl Zeiss, Germany) to analyze the co-expression of the two proteins.
2.6. Molecular modeling study
We acquired the protein structure co-crystallized with vismodegib from the Protein Data Bank (PDB code: 5L7I). Before docking studies, we prepared subunit B of the crystal structure for modeling through sequential optimization steps. This included proper protonation of amino acid residues, removal of crystallographic water molecules and bound ligand, and refinement of undefined loop regions. Subsequently, when the CHARMM force field parameters reached a minimized state, we obtained the optimal spatial conformation of WMC03. For docking studies, WMC03 was positioned in the native ligand’s binding site with a 10 Å exploration radius. All docking calculations were executed using AutoDock Vina 1.1.2, carefully evaluating output conformations. Finally, we utilized Discovery Studio 4.5 software to conduct an in-depth analysis of the interactions between WMC03 and the protein.
2.7. Cells and cell culture
The Daoy cell line was acquired from Wuhan Procell Life Science & Technology Co., Ltd. These cells were cultivated in MEM medium (Procell, China), enriched with 10% FBS (sourced from Evergreen, China), along with penicillin (at a concentration of 100 U/mL) and streptomycin (at 100 µg/mL). The cells were maintained in a humidified incubator set at 37°C and 5% CO2. Passage of the cells was conducted at regular intervals of every 2 days.
2.8. Cell proliferation assay
Exponentially growing Daoy cells were trypsinized, washed, and resuspended in fresh medium. Cell suspensions were then dispensed into 96-well plates at densities of 8,000-10,000 viable cells per well (100 µL total volume per well). Subsequently, the cells were incubated overnight at 37°C in an atmosphere containing 5% CO2 to promote cell adhesion to the plate. Vismodegib and WMC03 were initially dissolved in dimethyl sulfoxide (DMSO) and then diluted to the desired concentrations. The following day, these compounds were added to the wells to replace the existing medium, while the negative control group received medium without any drugs. The cells were further incubated for 48 h. Subsequently, MTT was added and incubated for 4 h, followed by the addition of DMSO to dissolve the formazan crystals with shaking for 10 min. The absorbance was measured at 490 nm using an ELISA plate reader to calculate cell viability and determine the IC50 value by curve fitting.
2.9. Western blot analysis
After treatment with Vismodegib and WMC03, Daoy cells were lysed using RIPA buffer containing PMSF (Beyotime, Shanghai, China). The lysates were then sonicated and centrifuged to isolate the supernatant, which was considered the total protein extract. Subsequently, the protein concentration was quantified using the Bicinchoninic Acid (BCA) assay. After determination, the proteins were denatured and stored for further use. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate the proteins, which were then transferred onto PVDF membranes sourced from Millipore (Shanghai, China). After blocking with skim milk, membranes were incubated overnight at 4°C with anti-Gli1 antibody (CST, USA). On the subsequent day, the membranes were incubated with the respective secondary antibodies provided by Beyotime Biotechnology (Shanghai, China) at room temperature. After washing with TBST, the membranes were developed using chemiluminescent reagents. Images were then captured using an ECL imaging system. Band analysis was conducted using ImageJ software, with β-actin serving as the internal control for normalization.
2.10. qRT-PCR analysis
RNA was isolated from Daoy cells that had undergone treatment with Vismodegib and WMC03 using the RNeasy Mini Kit. The concentration and quality of the extracted RNA were then assessed using a NanoDrop 2000 spectrophotometer. Subsequently, the RNA was reverse-transcribed to produce cDNA, and specific primers (GLI1, GAPDH) were used for real-time RT-PCR amplification using ChamQ SYBR qPCR Mix on a 7500 qPCR system to analyze gene expression. All primers were commercially synthesized by Takara Biotechnology with the following sequences: GLI1 forward primer: ‘ATCCTTACCTCCCAACCTCTGT’, reverse primer: ‘AACTTCTGGCTCTTCCTGTAGC’. GAPDH Forward primer: ‘AGAAGGCTGGGGCTCATTTG’, GAPDH Reverse primer: AGGGGCCATCCACAGTCTTC.
2.11. Wound healing assay
Daoy cells were seeded into a 6-well plate and incubated until reaching 80-90% confluence. A “cross” scratch was made using a pipette tip. After washing the cells, photographs were taken under a microscope to record the initial (0 h) scratch state. The medium was replaced with 2% FBS-containing media supplemented with varying concentrations of Vismodegib and WMC03, and cells were further incubated for 24 h. Photographs of the same areas were taken again to assess scratch closure percentage as a measure of cell migration capability.
2.12. Transwell migration and invasion assays
The migration and invasion abilities of Daoy cells were assessed using Transwell chambers, with the distinction that the invasion assay required coating the membrane with extracellular matrix gel. Cells were digested and formulated into suspensions, achieving a concentration of 1.5×105 cells per milliliter in serum-free medium that incorporated varying drug concentrations. Following this, 800 µL of medium supplemented with 10% FBS was dispensed into the lower chamber, while 200 µL of cell suspension, which contained varying doses of vismodegib and WMC03, was carefully pipetted into the upper chamber. After a 48 h incubation period in a cell culture incubator, the cells located in the upper chamber were subjected to fixation, staining, and subsequent gentle removal. Subsequently, the cells present in the lower chamber were examined under a microscope for enumeration, allowing for the assessment of both migratory and invasive capabilities.
2.13. Cell apoptosis assay
Daoy cells were seeded at 1.0×10⁶ cells/well and treated with WMC03 for 48 h. After treatment, both supernatant and cells were collected by centrifugation. The cell pellet was resuspended in Annexin V Binding Buffer to a density of 1×10⁶ cells/mL. For apoptosis analysis, 100 µL of cell suspension was stained with 5 µL Annexin V-FITC and 5 µL propidium iodide (PI) in the dark (15 min, RT). Appropriate controls were included: unstained cells, Annexin V-FITC single stain, and PI single stain. Finally, 400 µL of 1× binding buffer was added, and samples were analyzed within 1 h using a BD Accuri C6 Plus flow cytometer (BD Biosciences).
2.14. Statistical analysis
The values reported represent the mean ± standard error of the mean (SEM), calculated from at least three independent experiments. These data were analyzed utilizing GraphPad Prism software, specifically version 9.3. Statistical significance was assessed using Student’s t-test and analysis of variance (ANOVA). Differences were considered statistically significant when the P-value was less than 0.05.
3. Results and Discussion
3.1. Chemistry
The methodologies for synthesizing the target compounds have been outlined in Scheme 1. Isonicotinohydrazide reacted with carbon disulfide under alkaline conditions in refluxing ethanol to give potassium-pyridine-dithiocarbazate (6). In acidic conditions, the intermediate 6 underwent cyclization to convert to the thiadiazole thiol (7) at 0°C. Then, the cross-coupling reactions of diverse aryl halides with thiol 7 were catalyzed at 120°C using copper and the phenanthroline ligand to afford thiadiazole thioethers (8-23). These derivatives’ structures were identified by NMR & mass spectrometry (see Supplementary materials).

- Reagents and conditions: (a) CS2, KOH, ethanol, reflux, 20 h, yield 86%; (b) H2SO4, 0°C, 4 h, yield 53%; (c) different iodobenzene, iodide copper, 1,10-phenanthroline, K2CO3 DMF, 120°C, 10 h, yield 21-49%.
3.2. The HH signaling pathway inhibition by thiadiazole thioether analogs
Compound 1 served as the positive control in evaluating the inhibitory effects of compounds 8-23 on the Hedgehog (HH) pathway through GLI luciferase reporter assays. Quantitative analysis of their structure-activity relationships (SARs) was performed based on determined IC50 values, which have been comprehensively summarized in Table 1.
| Compd. | R1 | R2 | R3 | R4 | R5 | Gli-luc reporter IC50 (µM) |
|---|---|---|---|---|---|---|
| 8 | H | H | Cl | H | H | 6.81 ±0.38 |
| 9 | H | H | F | H | H | 12.59 ± 1.19 |
| 10 | H | H | COOCH3 | H | H | 3.93 ± 0.27 |
| 11 | Cl | H | H | H | H | 2.45 ± 0.20 |
| 12 | F | H | F | H | H | 9.86 ± 0.75 |
| 13 | F | Cl | H | H | H | 3.07 ± 0.14 |
| 14 | H | Cl | H | Cl | H | 17.12 ± 1.36 |
| 15 | Cl | H | F | H | H | ND |
| 16 | F | H | H | H | F | 1.65 ± 0.13 |
| 17 | H | F | H | H | H | 5.67 ± 0.31 |
| 18 | H | CF3 | H | H | H | 0.83 ± 0.06 |
| 19 | H | OCF3 | H | H | H | 6.19 ± 0.52 |
| 20 | H | H | OCF3 | H | H | 0.04 ± 0.02 |
| 21 | H | H | OCH2CH3 | H | H | 4.31 ± 0.12 |
| 22 | H | H | C(CH3)3 | H | H | 5.28 ± 0.35 |
| 23 | OCH3 | H | H | H | H | 0.01 ± 0.01 |
| 1 | 0.02 ± 0.01 |
Note: R1-R5 represent different substituent on the benzene ring.
Initially, the potency of chloro analog 8 was 1.8-fold higher than that of fluoro analog 9 when electron-withdrawing groups were introduced at the para position of the benzene ring. The introduction of carbomethoxy (10) or chlorine (11) into the ortho position of the phenyl group led to apparent improvement in activity, and the potency of ortho chloro analog 11 was 2.8-fold higher compared with that of para chloro analog 8. It was worth noting that the ortho difluoride substituent 16 was superior to other double electron-withdrawing substituents (12, 13, and 14). When fluoride is located at the meta position, the fluoro analog loses potency by 3.4-fold (17 vs. 16). However, the meta trifluoromethyl analog 18 exhibited improved potency (IC50=0.83μM). Further investigations focused on electron-donating groups on the benzene ring. Although para-substituents (20, 21, and 22) were more effective than meta-substituents against HH signaling (19), their potency was inferior to that of the ortho-substituent 23. Promisingly, the methoxyl-substituted compound 23 (WMC03) demonstrated the most robust anti-Hh activity within this category, featuring an IC50 value of 0.01 μM. Its efficacy was twice as high as that of the marketed compound 1.
To verify whether WMC03 functions as an antagonist for the SMO protein, researchers designed a competitive binding experiment based on fluorescently labeled cyclopamine (Figure 3). Upon binding to the SMO protein on the cell membrane, BODIPY-cyclopamine exhibits a distinct green fluorescence. When compared to vismodegib, WMC03 demonstrated a more pronounced fluorescence quenching effect. More importantly, as the concentration of WMC03 increased, the fluorescence intensity showed a gradual decrease, a finding that robustly supports the identity of WMC03 as a competitive antagonist for the binding of cyclopamine to the SMO protein.

- Results of the BODIPY-cyclopamine competitive binding assay based on SMO-293T cells. (Scale bar = 100 μm).
To investigate whether WMC03 inhibits the ciliary origin of HH signaling, this experiment assessed the formation of cilia in NIH3T3 cells overexpressing SMO-GFP through staining with acetylated α-tubulin (a fundamental component of cilia). We observed that WMC03 effectively reduced ciliogenesis in serum-starved NIH3T3 cells (Figure 4), strongly implying its inhibitory effect on HH pathway activation. These findings support the conclusion that WMC03 disrupts SMO signaling by interfering with cilium assembly.

- WMC03 inhibits cilium biogenesis. Typical images were acquired from immunofluorescence experiments carried out on NIH3T3 cells that were engineered to overexpress Smo-GFP and subsequently exposed to WMC03. The cilia were identified using an anti-AcTub antibody (specific for acetylated tubulin, displayed in red), SMO was directly visualized via its Green Fluorescent Protein (GFP) tag (shown in green), and cell nuclei were counterstained with 4’,6-Diamidino-2-phenylindole (DAPI) (appearing blue). Scale bar = 100 μm.
A study utilizing molecular docking technology was carried out to explore the binding mode of the target compounds with the SMO protein (PDB ID: 5L7I). As shown in Figure 5, WMC03 was located in the binding pocket closer to the upper opening of SMO. In their interaction mode, the sulfur atom of the thiadiazole in WMC03 formed an H-bond with ASN219, and its methoxyl group formed non-classical H-bonds with TYR394, LYS395, and GLN477. The thiadiazole and pyridine moieties interacted with ASP384 via π-anion electrostatic force. Additionally, a π-π stacked interaction emerged between the benzene ring and PHE484. The thiadiazole and pyridine of WMC03 also interacted with PRO513 and VAL386 through π-alkyl hydrophobic interactions. The molecular-level computational simulation provided insights into the moderate inhibitory effect of WMC03 on SMO.

- Schematic diagram of molecular docking results. Binding conformation of WMC03 (green) at the target site. Dashed green lines denote hydrogen bonds. Dashed brown lines depict electrostatic forces. Dashed pink lines illustrate hydrophobic interactions. Interacting amino acids are displayed in gray stick style with labels.
3.3. In vitro antitumor activity of WMC03
The aberrant activation of HH signaling is tightly associated with MB, so the antiproliferative effect of WMC03 on Daoy cells was assessed using the MTT assay. When exposed to progressively higher concentrations of WMC03, the viability of Daoy cells decreased significantly (Figure 6). The IC50 value of WMC03 against Daoy cells was determined to be 13.215 ± 1.345 µM, which is 4-fold higher than that of vismodegib.

- Cytotoxicity of Daoy cells was assessed after treatment with vismodegib and WMC03. MTT assay was utilized to measure cell viability. Results are reported as mean ± S.D. from three independent experiments (*P < 0.05, **P < 0.01 vs. vismodegib, n=3).
Daoy cells, known for their high expression of HH signaling pathway components, exhibited a dose-dependent decrease in GLI1 protein levels following treatment with WMC03, as evidenced by Western blot analysis. Specifically, at a concentration of 10 µM, WMC03 showed a more significant downregulation of GLI1 protein compared to vismodegib (Figure 7). In line with expectations, WMC03 treatment also led to a dose-dependent reduction in the mRNA expression of GLI1, a target gene of the HH pathway (Figure 8). Notably, at the 10µM concentration, the mRNA expression level of GLI1 was markedly lower in cells treated with WMC03 than in those treated with vismodegib. These results demonstrate that WMC03 effectively inhibits cell proliferation and promotes cell death by suppressing the HH signaling pathway.

- Western blot analysis was conducted to detect GLI1 levels in Daoy cells treated with vismodegib and WMC03, using β-actin as an internal control. The results are displayed as the mean ± standard deviation (SD) derived from three independent experiments.

- Real-time RT-qPCR was carried out to evaluate the levels of GLI1 mRNA in Daoy cells that had been treated with Vismodegib and WMC03. The data were normalized using GAPDH as an internal reference. The expression levels are presented as fold-change relative to the Control group. The results are shown as the mean ± SD from three separate experiments. (*P < 0.05, ***P < 0.001 vs. Control; ##P < 0.01 vs. vismodegib (10 μM), n = 3).
Considering the crucial role of the activated HH signaling pathway in facilitating tumor metastasis, we carefully devised wound healing and transwell migration assays to investigate the potential effects of WMC03 on this process. The experimental results, as depicted in Figure 9(a), show that at both 24-h and 48-h time points, WMC03 significantly inhibits the migratory potential of Daoy cells, with this inhibitory effect positively correlating with the concentration of WMC03; in other words, the higher the concentration, the more pronounced the obstruction of cell migration. Furthermore, Figure 9(b) provides deeper insights into the influence of WMC03 on the migratory and invasive capabilities of Daoy cells. Within 48 h, WMC03 not only markedly decreased the cells’ migratory ability but also exerted a strong inhibitory effect on their invasive capacity, and this dual inhibitory effect intensified as the concentration of WMC03 increased. Notably, at a concentration of 10µM, WMC03 demonstrated superior efficacy compared to vismodegib, exhibiting a lower wound healing rate and significantly decreased cell migration and invasion rates.

- Daoy cells treated with Vismodegib and WMC03 underwent wound healing and transwell migration assays. (a) Photos taken at designated time points during the wound healing process. (b) Images from the transwell migration experiment. Results are presented as mean ± SD from three independent experiments. (Scale bar = 50 μm).
Using Annexin V/propidium iodide dual staining, we quantified WMC03-mediated apoptosis in medulloblastoma cells, observing progressive elevation of apoptotic cell percentages with increasing drug concentrations (Figure 10). At a concentration of 10µM, the apoptosis rate of Daoy cells induced by WMC03 was 25.42%, which was 1.43 times that of vismodegib.

- Cell apoptosis analysis in Daoy cells treated with Vismodegib and WMC03. (a) Analysis of apoptosis by flow cytometry. (b) Graphical representation of the total percentage of apoptosis induced by Vismodegib and WMC03. (*P < 0.05 vs. Control; #P < 0.05 vs. Vismodegib (10 μM), n = 3).
4. Conclusions
We have developed a series of novel HH signaling pathway inhibitors with a thiadiazole thioether core structure and elaborated on their extended SAR. Among them, WMC03 stands out, demonstrating extremely potent HH pathway inhibitory activity with a half maximal inhibitory concentration (IC50) as low as 0.01 μM. WMC03, through competitive binding with the SMO protein, demonstrated its inhibitory effect on ciliogenesis using immunofluorescence techniques. Molecular docking simulations revealed the complex interactions between WMC03 and SMO, formed through hydrogen bonding, electrostatic forces, and hydrophobic interactions. Further research has demonstrated that WMC03 exhibits potent antiproliferative effects on Daoy cells, with an IC50 value of 13.215 µM. Additionally, WMC03 is effective in reducing the expression levels of GLI1 protein and its mRNA, while inhibiting cell migration and inducing apoptosis. Specifically, at a concentration of 10µM, the apoptosis rate induced by WMC03 can reach 25.42%. Given these research findings, as a thiadiazole thioether-type inhibitor of the HH pathway, WMC03 shows great promise as a potential future effective therapeutic agent in targeted therapies for HH-dependent medulloblastoma.
Acknowledgment
This work was supported financially by the National Natural Science Foundation of China (82003656), the Project of Science and Technology Department of Liaoning Province (2023-MS-328, 2023-BSBA-289 and 2025-MSLH-660), General Project of Educational Department of Liaoning Province for Higher Education Institutions (LJKQZ2021178 and LJKZ1142) and Shenyang Young and Middle-aged Science and Technology Innovation Talent Support Program (RC210189).
CRediT authorship contribution statement
Hongjuan Li and Shu Han were co-first authors of this article and contributed equally to this work.
Declaration of competing interest
There are no conflicts to declare.
Declaration of generative AI and AI-assisted technologies in the writing process
The authors confirm that there was no use of artificial intelligence (AI)-assisted technology for assisting in the writing or editing of the manuscript and no images were manipulated using AI.
References
- MEDB-21. SOX2+ cells: The perpetrators of medulloblastoma relapse. Neuro-Oncology. 2022;24:i109. https://doi.org/10.1093/neuonc/noac079.395
- [Google Scholar]
- ANGI-09. Unraveling the involvement of BAIAP2 and CDC42 in medulloblastoma pathogenesis. Neuro-Oncology. 2023;25:v2-v3. https://doi.org/10.1093/neuonc/noad179.0009
- [Google Scholar]
- Advancing drug discovery: Thiadiazole derivatives as multifaceted agents in medicinal chemistry and pharmacology. Bioorganic & Medicinal Chemistry. 2024;112:117876. https://doi.org/10.1016/j.bmc.2024.117876
- [Google Scholar]
- Perioperative risk factors for long‐term intelligence in children with postoperative cerebellar mutism syndrome after medulloblastoma surgery. Pediatric Blood & Cancer. 2022;69:e29536. https://doi.org/10.1002/pbc.29536
- [Google Scholar]
- TORC1/2 kinase inhibition depletes glutathione and synergizes with carboplatin to suppress the growth of MYC-driven medulloblastoma. Cancer Letters. 2021;504:137-145. https://doi.org/10.1016/j.canlet.2021.02.001
- [Google Scholar]
- Post-radiation cisplatin and etoposide as systemic treatment in newly diagnosed adult medulloblastomas: A retrospective, single institution, longitudinal evaluation of clinical outcomes and toxicity. Journal of Clinical Oncology. 2022;40:e14046. https://doi.org/10.1200/jco.2022.40.16_suppl.e14046
- [Google Scholar]
- Survey of Canadian neuro-oncology clinicians about the treatment of adult medulloblastoma. Neuro-Oncology Advances. 2023;5:i11. https://doi.org/10.1093/noajnl/vdad071.046
- [Google Scholar]
- A phase II trial of nifurtimox combined with topotecan and cyclophosphamide for refractory or relapsed neuroblastoma and medulloblastoma. International Journal of Cancer. 2023;153:1026-1034. https://doi.org/10.1002/ijc.34569
- [Google Scholar]
- Enhancing targeted therapy by combining PI3K and AKT inhibitors with or without cisplatin or vincristine in medulloblastoma cell lines in vitro. Biomedicine & Pharmacotherapy. 2024;180:117500. https://doi.org/10.1016/j.biopha.2024.117500
- [Google Scholar]
- Pathology, diagnostics, and classification of medulloblastoma. Brain Pathology (Zurich, Switzerland). 2020;30:664-678. https://doi.org/10.1111/bpa.12837
- [Google Scholar]
- Recent advances in the molecular understanding of medulloblastoma. Cancer Science. 2023;114:741-749. https://doi.org/10.1111/cas.15691
- [Google Scholar]
- MDB-04. Single-cell transcriptomic analysis reveals distinct genomic landscapes, cell trajectories, and tumour-microenvironment interactions in four subtypes of medulloblastoma. Neuro-Oncology. 2023;25:i62. https://doi.org/10.1093/neuonc/noad073.237
- [Google Scholar]
- Arrested development: The dysfunctional life history of medulloblastoma. Genes & Development. 2025;39:4-17. https://doi.org/10.1101/gad.351936.124
- [Google Scholar]
- CSIG-28. The hedgehog gene expression program regulates lipid feedback mechanisms underlying hedgehog-associated medulloblastoma. Neuro-Oncology. 2022;24:vii45. https://doi.org/10.1093/neuonc/noac209.177
- [Google Scholar]
- Targeting AKT and CK2 represents a novel therapeutic strategy for SMO constitutive activation‐driven medulloblastoma. CNS Neuroscience & Therapeutics. 2022;28:1033-1044. https://doi.org/10.1111/cns.13835
- [Google Scholar]
- Characterization of patients with advanced basal cell carcinoma progressing while receiving Hedgehog pathway inhibitors. The British Journal of Dermatology. 2022;186:579-581. https://doi.org/10.1111/bjd.20808
- [Google Scholar]
- Keratin19 promotes pancreatic cancer progression and poor prognosis via activating the Hedgehog pathway. International Journal of Oncology. 2023;62:43. https://doi.org/10.3892/ijo.2023.5491
- [Google Scholar]
- Update on glasdegib in acute myeloid leukemia – broadening horizons of Hedgehog pathway inhibitors. Acta Pharmaceutica. 2022;72:9-34. https://doi.org/10.2478/acph-2022-0007
- [Google Scholar]
- ATF4 Transcriptionally activates SHH to promote proliferation, invasion, and migration of gastric cancer cells. Cancers. 2023;15:1429. https://doi.org/10.3390/cancers15051429
- [Google Scholar]
- B13, a well-tolerated inhibitor of hedgehog pathway, exhibited potent anti-tumor effects against colorectal carcinoma in vitro and in vivo. Bioorganic Chemistry. 2023;135:106488. https://doi.org/10.1016/j.bioorg.2023.106488
- [Google Scholar]
- The role of the hedgehog pathway in chemoresistance of gastrointestinal cancers. Cells. 2021;10:2030. https://doi.org/10.3390/cells10082030
- [Google Scholar]
- The Hira complex regulates Gli3R-dependent transcription in Hedgehog signaling and medulloblastoma cell growth and migration. Scientific Reports. 2025;15:324. https://doi.org/10.1038/s41598-024-83468-3
- [Google Scholar]
- Review of the molecular genetics of basal cell carcinoma; inherited susceptibility, somatic mutations, and targeted therapeutics. Cancers. 2021;13:3870. https://doi.org/10.3390/cancers13153870
- [Google Scholar]
- ABT-737 suppresses aberrant Hedgehog pathway and overcomes resistance to smoothened antagonists by blocking Gli. Medical Oncology (Northwood, London, England). 2022;39:188. https://doi.org/10.1007/s12032-022-01794-w
- [Google Scholar]
- The Hedgehog pathway and its inhibitors: Emerging therapeutic approaches for basal cell carcinoma. Drug discovery today. 2022;27:1176-1183. https://doi.org/10.1016/j.drudis.2021.12.005
- [Google Scholar]
- The hedgehog pathway in hematopoiesis and hematological malignancy. Frontiers in Oncology. 2022;12:960943. https://doi.org/10.3389/fonc.2022.960943
- [Google Scholar]
- Pharmacokinetics and pharmacodynamics of Hedgehog pathway inhibitors used in the treatment of advanced or treatment-refractory basal cell carcinoma. Expert Review of Clinical Pharmacology. 2023;16:1211-1220. https://doi.org/10.1080/17512433.2023.2285849
- [Google Scholar]
- A phase 1b study of the Notch inhibitor crenigacestat (LY3039478) in combination with other anticancer target agents (taladegib, LY3023414, or abemaciclib) in patients with advanced or metastatic solid tumors. Investigational New Drugs. 2021;39:1089-1098. https://doi.org/10.1007/s10637-021-01094-6
- [Google Scholar]
- Repurposed itraconazole for use in the treatment of malignancies as a promising therapeutic strategy. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie. 2022;154:113616. https://doi.org/10.1016/j.biopha.2022.113616
- [Google Scholar]
- Affinity-based protein profiling identifies vitamin D3 as a heat shock protein 70 antagonist that regulates hedgehog transduction in murine basal cell carcinoma. European Journal of Medicinal Chemistry. 2022;228:114005. https://doi.org/10.1016/j.ejmech.2021.114005
- [Google Scholar]
- Itraconazole halts hepatocellular carcinoma progression by modulating sonic hedgehog signaling in rats: A novel therapeutic approach. Pathology, Research and Practice. 2024;253:155086. https://doi.org/10.1016/j.prp.2023.155086
- [Google Scholar]
- MEVITEM—a phase I/II trial of vismodegib + temozolomide vs temozolomide in patients with recurrent/refractory medulloblastoma with Sonic Hedgehog pathway activation. Neuro-Oncology. 2021;23:1949-1960. https://doi.org/10.1093/neuonc/noab087
- [Google Scholar]
- PPAR gamma targeted molecular docking and synthesis of some new amide and urea substituted 1, 3, 4‐thiadiazole derivative as antidiabetic compound. Journal of Heterocyclic Chemistry. 2020;57:2213-2224. https://doi.org/10.1002/jhet.3941
- [Google Scholar]
- Retraction notice to “Synthesis, carbonic anhydrase enzyme inhibition evaluations, and anticancer studies of sulfonamide based thiadiazole derivatives” [BMCL 57 (2022) 128520] Bioorganic & Medicinal Chemistry Letters. 2022;65:128720. https://doi.org/10.1016/j.bmcl.2022.128720
- [Google Scholar]
- Greener approaches for synthesis of bioactive thiadiazole scaffolds. Current Organocatalysis. 2023;10:237-249. https://doi.org/10.2174/2213337210666230210142303
- [Google Scholar]
- Novel 1,3,4-thiadiazol derivatives including α-lipoic acid: Synthesis, characterization, and antioxidant properties. Journal of Molecular Structure. 2024;1307:137980. https://doi.org/10.1016/j.molstruc.2024.137980
- [Google Scholar]
- Synthesis, antiproliferative and 4D-QSAR studies of thiadiazole derivatives bearing acrylamide moiety as EGFR inhibitors. SAR and QSAR in Environmental Research. 2023;34:341-359. https://doi.org/10.1080/1062936X.2023.2214870
- [Google Scholar]
- Rationale design and synthesis of new apoptotic thiadiazole derivatives targeting VEGFR-2: Computational and in vitro studies. RSC Advances. 2023;13:35853-35876. https://doi.org/10.1039/d3ra07562a
- [Google Scholar]
- Synthesis of 1,3,4-Thiadiazole derivatives and their anticancer evaluation. International Journal of Molecular Sciences. 2023;24:17476. https://doi.org/10.3390/ijms242417476
- [Google Scholar]
- Synthesis, DFT studies, and biological evaluation of new quinazoline-1,3,4-thiadiazole derivatives as anti-proliferative agents. Chemistry Africa. 2024;7:2383-2395. https://doi.org/10.1007/s42250-024-00945-y
- [Google Scholar]
- Discovery of potent and novel smoothened antagonists via structure-based virtual screening and biological assays. European Journal of Medicinal Chemistry. 2018;155:34-48. https://doi.org/10.1016/j.ejmech.2018.05.035
- [Google Scholar]
- Carbocisteine as a modulator of Nrf2/HO-1 and NFκB interplay in rats: New inspiration for the revival of an old drug for treating ulcerative colitis. Frontiers in Pharmacology. 2022;13:887233. https://doi.org/10.3389/fphar.2022.887233
- [Google Scholar]
- Clinical correlates of anxiety disorders : Tunisian study about 436 subjects. European Psychiatry. 2022;65:S389-S390. https://doi.org/10.1192/j.eurpsy.2022.985
- [Google Scholar]
- Interaction of drugs with gut microbiota modulators. Drug Metabolism Reviews. 2023;55:181-194. https://doi.org/10.1080/03602532.2023.2197178
- [Google Scholar]
- Synthesis and investigation of S-substituted 2-mercaptobenzoimidazoles as Inhibitors of hedgehog signaling. ACS medicinal Chemistry Letters. 2017;8:931-935. https://doi.org/10.1021/acsmedchemlett.7b00100
- [Google Scholar]
