Chemical composition and antibacterial activity of the essential oil and various extracts from Cassia sophera L. against Bacillus sp. from soil

2.1 Isolation and identification of bacteria from soil

20 g of fresh collected soil were suspended in sterile NaCl (0.9%) and maintained on a rotary shaker for 45 min at the maximum speed. The suspension was serially diluted, plated on PCA (Plate Count Agar) medium (pH 7.0, Sigma) and incubated at 30 °C under aerobic conditions for 15 days. Most representative colonies were randomly collected from plates, purified by streaking twice and stored as stock cultures in 20% (v/v) glycerol at −80 °C for their genetic identification by 16S rDNA sequencing as previously described (Rahman et al., in press; McCaig et al., 2001). PCR was performed in a final volume of 25 μl containing buffer 10×, 1.0 unit of TaqDNA polymerase (Amersham Biosciences), 0.2 mM each of dNTPs, 200 nM of each primer 63F 5′CAGGCCTAACACATGCAAGTC (Marchesi et al., 1998) and 1389R 5′ACGGGCGGTGTGTACAAG (Osborn et al., 2000) and 50 ng template DNA. The thermal cycler (Bio Rad ICycler 170–8740) was programed for the initial denaturation step (94 °C) of 5 min., followed by 44 cycles of 1 min. denaturation along with 1 min. primer annealing (37 °C) and 2 min. primer extension (72 °C), followed by the 7 min primer extension (72 °C) step. The amplified DNA was visualized by gel electrophoresis. The most similar bacterial species was found in the GenBank by using BLAST search (http://www.ncbi.nlm.nih.gov). Neighbor-joining phylogenetic trees were constructed based on 16S rDNA sequences using Jalview version 2.7.

2.2 Plant material

The leaves of C. sophera L. were collected from the local market of Kushtia of Bangladesh in March 2011 and identified by Bangladesh National Herbarium, Dhaka. The voucher specimen number is DACB 38078.

2.3 Isolation of the essential oil

About 200 g powdered leaves of C. sophera L. were subjected to hydrodistillation for 3 h using a Clevenger type apparatus. The oil was dried over anhydrous Na₂SO₄ and preserved in a sealed vial at 4 °C until further analysis.

2.4 Preparation of organic extracts

The air-dried powdered leaves (100 g) of C. sophera L. were extracted with 250 ml of each organic solvent (hexane, chloroform, ethyl acetate and methanol) separately for 7 days at room temperature and the solvents were evaporated by vacuum rotary evaporator (EYELA N-1000, Japan). The extraction process yielded hexane (7.3 g), chloroform (6.2 g), ethyl acetate (7.4 g) and methanol (6.5 g) extracts. Solvents (analytical grade) for extraction were obtained from commercial sources (Sigma–Aldrich, St. Louis, MO, USA).

2.5 Gas chromatography–mass spectrometry (GC–MS) analysis

The GC–MS was carried out using total ion monitoring mode on a Varian 3800 gas chromatograph interfaced to a Varian Saturn ion trap 2200 GC–MS spectrometer. The temperatures of transfer line and ion source were 280 and 275 °C respectively. Ions were obtained by electron ionization mode. The VF-5 capillary column (30 m length, 0.25 mm I.D. and 0.25 μm film thickness) were used. A 20% split injection mode was selected with a solvent delay time of 3 min. with an injection volume of 0.2 μl. The initial column temperature was started at 50 °C for 1 min., programed at 8 °C/min to 200 °C and heated until 280 °C at 10 °C/min. Injection port was set at 250 °C. Helium was used as the carrier gas at a constant flow rate of 1.0 ml/min. Molecular ions (mass range: 40–500 m/z) were monitored for identification. The relative percentage of the oil constituents was expressed as percentage by peak area normalization. Identification of components of the essential oil was based on their retention indices, relative to a homologous series of n-alkane (C₈–C₂₀) on the VF-5 capillary column under the same operating conditions and computer matching with the GC–MS spectra from the Wiley 6.0 MS data and literature data (Adams, 2007).

2.6 Antibacterial assay

The dried extracts were dissolved in the same solvent used for their extraction and sterilized by filtration using a 0.22 μm sterile Millipore filter (Millipore Corp., Billerica, MA, USA). Then the antibacterial test was carried out by agar disc diffusion method (Murray et al. 1995) using 100 μl of standardized inoculum suspension containing 10⁷ CFU/ml of bacteria. The essential oil was diluted 1:5 (v/v) with methanol and aliquots of 10 μl were spotted onto the sterile Whatman No. 1 filter paper discs (6 mm diameter); while 10 μl of 30 mg/ml of each organic extract (300 μg/disc) was applied on the filter paper discs and placed on the inoculated LB agar medium. Negative controls were prepared using the same solvents employed to dissolve the samples. Standard antibiotic, streptomycin (10 μg/disc) and kanamycin (30 μg/disc) from Sigma–Aldrich Co., St. Louis, MO, USA) was used as positive control for the tested bacteria. The plates were incubated micro aerobically at 37 °C for 24 h. Antibacterial activity was evaluated by measuring the diameter of the zones of inhibition against the tested bacteria. Each assay in this experiment was replicated three times.

2.7 Minimum inhibitory concentration (MIC)

The minimum inhibitory concentration (MIC) of essential oil and organic extracts was assessed according to Al-Reza et al. (2011). Active cultures for MIC determination were prepared by transferring a loopful of cells from the stock cultures to flasks and inoculated in LB medium and incubated at 37 °C for 24 h. The tested samples were incorporated into LB broth medium to get the final concentration ranging from 0 to 1000 μg/ml. Finally, 20 μl inoculums of each bacterial strain (10⁷ CFU/ml) was transferred to each tube and the tests were performed in a volume of 2 ml. The control tube contained only organisms and not the tested samples. The culture tubes were incubated at 37 °C for 24 h. The lowest concentration of the test samples, which did not show any visual growth of tested organisms after macroscopic evaluation, was determined as MIC, which was expressed in μg/ml.

3.1 Identification of bacteria

Molecular identification was developed and adopted almost 20 years ago to detect bacterial species and is generally based on the identification of some unique parts of their 16S rDNA (Lynch et al., 2004). Therefore, 16S rDNA-based techniques have been widely used to characterize microbial community structure in soil samples (Rahman et al., in press; Li et al., 2006). DNA was extracted from soil isolates. 16S rDNA was subjected to PCR to amplify for identification of bacterial species and amplified 16S rDNA products were confirmed by gel electrophoresis through the visualization of their band patterns. Based on the 16S rDNA sequences, the bacteria were identified as the following Bacillus sp. as compared with the known sequences in the public databases in NCBI and the BLAST results are given in the Table 1. Phylogenic tree are constructed as in Fig 1. The sequences of isolates are showing maximum similarity of 100% for Bacillus simplex, Bacillus cereus, Bacillus megaterium and Paenibacillus BF38 and 99% for Paenibacillus sp. L32 and Terribacillus sp. 3LF and shown in Table 1.

Close

Figure 1

Phylogenic tree of identified bacteria. The phylogenic tree is shown in the Phylogram. Bootstrap values (expressed as percentages of 100 replications) are shown at branch points; values greater than 50% were considered significant. The bar represents the unit length of the number of nucleotide substitutions per site.

Export to PPT

3.2 Chemical composition of the essential oil

With the growing interest of the use of essential oils in food and pharmaceutical industries, examination of plant extracts for these properties has become of increasing importance (Jirovetz et al., 2002; Baratta et al., 1998). Leaves of C. sophera L. have been a traditional spice since ancient times. The steam distillation of dried leaves of C. sophera L. gave yellowish essential oil (yields ∼0.79%, w/w). The identified compounds, qualitative and quantitative analytical results by GC–MS, are shown in Table 2. In this study, twenty-nine constituents accounting for 94.14% of total oil compositions were identified. The oil contains a complex mixture in which Benzyl Alcohol (9.08%), Isoeugenol (4.94%), Germacrene D (4.82%), Isocreosol (5.69%), Phenylethyl Alcohol (5.03%), Azulene (4.65%), Linolenic acid (1.56%) were the major compounds. The essential oil from spices has been known to possess biological activities, notably antimicrobial properties, since ancient times. It is also possible that the minor component might be involved in some type of synergism with the other active compounds. Thus, essential oil of C. sophera L. is being considered as a potential alternative to synthetic bactericides or as a leading compound for new classes of natural bactericides. This activity could be attributed to the presence of oxygenated mono-and sesquiterpene hydrocarbons and these findings are in agreement with the previous reports (Shunying et al., 2005). However, it is noteworthy that the composition of the essential oils from a particular species of plant can differ between harvesting seasons, extraction methods, and geographical sources, and that those from the different parts of the same plant can also differ widely (Burt, 2004) .

3.3 Antibacterial activity of essential oil and various extracts of leaves of C. sophera L.

In this study, antibacterial activity of essential oil and different extracts of leaves of C. sophera L. were determined against Bacillus sp. Plants have provided a source of inspiration for novel drug compounds as plant derived medicines have made significant contribution toward human health. Antimicrobial characteristics of the herbs are due to various chemical compounds including volatile oils, alkaloids, tannins and lipids that are presented in their tissue (Con et al., 1980). Preliminary clinical trials have documented its therapeutic use for the treatment of a variety of diseases and conditions that include cough, bronchitis, headache, eczema, fever, diarrhea, asthma, hypertension, diabetes, and inflammation. In a recent survey, pharmacological studies have been conducted on the ethanol, chloroform, Hexane and ethyl acetate extracts of leaves of C. sophera L. to evaluate their effects on antibacterial activity. Some researchers noted that C. sophera L. is an emerging alternative antimicrobial agent for human applications (Rahman et al., 2009; Kirtikar and Basu, 2000).Thus according to our investigation C. sophera L. has antibacterial potential and can be used as a potent antibacterial agent for human pathogenic and soil bacteria.

The in vitro antibacterial activity of essential oil and various extracts (ethanol, chloroform, hexane and ethyl acetate) of C. sophera L. against the isolated bacteria was qualitatively assessed by the presence of inhibition zones. According to the results given in Table 3, a total of six soil bacteria were tested. The oil exhibited antibacterial activity against all tested bacteria at a concentration of 10 μL of 1:5 (v/v) dilutions with ethanol. The oil exhibited a noticeable antibacterial effect against the tested bacteria, with diameter of inhibition zones ranging from 16.4 to 22.2 mm, as shown in Table 3. The results showed that the ethanol solvent of the essential oil leaves of C. sophera L. had the considerable antimicrobial activity. This result is similar to previous researcher’s results (Afolayan and Meyer, 1995; Kuhnt et al., 1995).

Various organic extracts from leaves of C. sophera L. also revealed a good antibacterial activity against all bacteria, at a concentration of 300 μg/disc (Table 3). Ethanol extract showed the strongest antibacterial effect against B. megaterium and B. cereus with their respective diameter zones of inhibition of 24.9 ± 0.4 and 22.1 ± 0.6 mm, whereas chloroform extract showed the strongest effect against B. cereus (inhibition zone 21.8 ± 0.3 mm). On the other hand, hexane and ethyl acetate extracts showed interesting antibacterial effect with inhibition zones in the range of 14.2 ± 0.4–22.2 ± 0.3 and 12.6 ± 0.4–20.8 ± 0.5, respectively. In some cases, the oil and organic extracts exhibited higher antibacterial activity compared with standard samples amoxicillin and erythromycin.

3.4 Minimum inhibitory concentration (MIC)

In this study, Bacillus sp. was found to be more susceptible to the essential oil. As shown in Table 4, the MIC values for the oil were found to be lower for B. megaterium, B. simplex, Terribacillus sp. 3LF and B. cereus, (62.5–125 μg/ml) than for Paenibacillus sp. L32 and Paenibacillus sp. BF38 (250–500 μg/ml). The MIC values of the organic extracts of ethanol, chloroform, hexane and ethyl acetate against the tested bacteria were found in the range of 62.5–500 μg/ml (Table 4) the highest MIC values suggest that the leaf extracts are less susceptible. The antibacterial activity of organic extract could be attributed to the presence of some bioactive phytochemicals (alkaloids, flavonoids, steroids, terpenoids, etc.) in leaves of C. sophera L. These findings are in agreement with the previous report (Rahman et al., 2009) from literatures that C. sophera L. has those compounds).