A novel resonance Rayleigh scattering aptasensor for dopamine detection based on an Exonuclease III assisted signal amplification by G - quadruplex nanowires formation

2.1 Chemical and material

Dopamine was purchased from Alfa Aesar of Thermo Fisher Scientific (Shanghai, China). Uric Acid was purchased from Fluka. Ascorbic Acid was purchased from Tianjin Yongda Chemical Reagent Co., Ltd. Epinephrine and serotonin was purchased from SIGMA. Glucose was purchased from Shijiazhuang Reagent Factory. Tris was obtained from Sangon Biotech (Shanghai) Co., Ltd. NaCl was purchased from Guangdong Shantou Xilong Chemical Co., Ltd. KCl was purchased from Shanghai Kechang Fine Chemicals Co., Ltd. MgCl₂ was purchased from Tianjin Chemical Reagent Co., Ltd. Exonuclease III was purchased from Takara Biomedical Technology (Beijing) Co., Ltd. HCl was purchased from Tianjin Fengchuan Chemical Reagent Technology Co., Ltd. The rapid silver dye kit for nucleic acid was obtained from Real-Times Biotechnology Co., Ltd (Beijing, China). The dopamine ELISA kit was supplied by Elabscience Biotechnology Co., Ltd (Wuhan, China). Tris–HCl buffer solution A (pH 7.4) contained 20 mmol/L Tris, 100 mmol/L NaCl, 5 mmol/L MgCl₂. Tris–HCl buffer solution B (pH 7.4) contained 10 mmol/L Tris, 150 mmol/L KCl, 200 mmol/L MgCl₂. All other chemicals used were of analytical reagent grade. Ultra-high pressure water (18.25 MΩ cm) was used in the experiments. Dopamine aptamer and hairpin DNA and dopamine were purchased from Shanghai Sangon Biological Engineering Technology &Services Co., Ltd. The sequences were shown as follows:

• Dopamine aptamer: 5′- GTCTCTGTGTGCGCCAGAGAACACTGGGGCAGATATGGGCCAG CA CAGAATGAGGCCC-3′

• Hairpin DNA1: 5′- GACAGGGTGGGGAGGGTGGGGCCACCCT-3′ (The 5 ′end of which has 3 bases that complement the dopamine aptamer.)

• Hairpin DNA2: 5′- GAGACAGGGTGGGGAGGGTGGGGCCACCCT-3′ (The 5 ′end of which has 5 bases that complement the dopamine aptamer.)

• Hairpin DNA3: 5′- CAGAGACAGGGTGGGGAGGGTGGGGCCACCCT-3′ (The 5 ′end of which has 7 bases that complement the dopamine aptamer.)

• Hairpin DNA4: 5′- CACAGAGACAGGGTGGGGAGGGTGGGGCCACCCT-3′ (The 5 ′end of which has 9 bases that complement the dopamine aptamer.)

• Hairpin DNA5: 5′-CACACAGAGACAGGGTGGGGAGGGTGGGGCCACCCT-3′ (The 5 ′end of which has 11 bases that complement the dopamine aptamer.)

2.2 Apparatus

F-7000 fluorescence spectrophotometer (Hitachi, Japan) equipped with a 150 W Xe lamp was used to record the Resonance Rayleigh scattering spectra. The experimental temperature was controlled by LS-2500 cryogenic thermostatic tank (Nanjing xinchen biotechnology Co., Ltd). The water used throughout the experiment was supplied by SMART ultra-pure water system (Heal Force SMART-N, Heal Force Development Ltd.). The pH of each solution was measured with a PHSJ-3F potentiometer (Shanghai Electronic Science Instrument Co., Ltd). Electrophoresis was carried out using a JY - CX3B sequencing electrophoresis of JY – ECP 3000 electrophoresis power (Beijing Junyi Electrophoresis Equipment Co., Ltd).

2.3 Detection of dopamine

The specific method of dopamine detection was as follows: At first, the prepared hairpin DNA was heated to 95 °C for 5 min and then allowed to slowly cool down to room temperature for 2 h before using. The hybridization reaction was performed by mixing dopamine aptamer (3.0 μM, 20.0 μL), hairpin DNA (3.0 μM, 20.0 μL) and 20.0 μL dopamine solutions of different concentrations in Tris–HCl buffer solution A (20.0 mM Tris, pH 7.4). The mixture was incubated for 2 h at 4 °C. Subsequently, 10.0L Exo Ш solution (6.0U/μL) was added to the solution and the mixture was incubated for 1 h at 4 °C. Then 230.0 μL Tris–HCl buffer solution B (150.0 mM KCl, 200.0 mM MgCl₂, pH 7.4) was added and placed at 4 °C for 2 h to promote G- quadruplexes polymerization to form large G-wire nanostructures which were orderly assembled. Fluorescence spectrophotometer was used to detect the RRS spectrum of the solutions. Constantly low temperature tank was equipped to control the experimental temperature at 4 °C. The wavelength of resonance Rayleigh scattering spectrum was measured by synchronous scanning at λ_ex = λ_em (Δλ = 0 nm). The scanning range of synchronous fluorescence wavelength is from 220 nm to 650 nm with the slits (EX/EM) of 10.0/10.0 nm. In the experiment, the voltage of photoelectric multiplier (PMT) was selected as 400 V. The raised the RRS intensity (ΔI) was considered as ΔI = I₁ − I₀, where I₁ and I₀ represent the RRS intensity of mixture in presence or absence of dopamine, respectively.

2.4 Polyacrylamide gel electrophoresis

Polyacrylamide gel electrophoresis (PAGE) analysis was conducted to prove the specific binding of dopamine with aptamer and the formation of G-wire. Samples for PAGE analysis were prepared as follows: (1) DNA marker was sample 1; (2) hairpin DNA (3.0 μM) was sample 2; (3) dopamine aptamer (3.0 μM) was sample 3; (4) a mixture of 3.0 μM hairpin DNA, 3.0 μM dopamine aptamer, 30 nM dopamine, 150.0 mM K⁺ and 200.0 mM Mg²⁺ was incubated and used as sample 4; (5) a mixture of a mixture of 3.0 μM hairpin DNA, 3.0 μM dopamine aptamer, 150.0 mM K⁺ and 200.0 mM Mg²⁺ was incubated and used as sample 5. Samples verified with electrophoresis were prepared according to the “Detection of dopamine” procedure. During the 12% polyacrylamide gel separation, the sample and 6 × loading buffer solution were performed in a volume ratio of 5: 1. The electrophoresis process was carried out in a 1 × TBE buffer solution, and electrophoresis was continuously performed for 5 h at a constant voltage of 200 V. Silver staining was performed according to the instructions of the silver staining kit, which were briefly described as follows: The gel plate was first placed in a 100 mL stain and shaken evenly for 5 min. Then, the staining solution was drained, and the gel was shaken in a 100 mL silver staining solution at a constant rate for 10 min. Finally, after adding ultrapure water of 100 mL to the pan and shook for 5 min to rinse the gel, the expected nucleic acid band can be observed.

2.5 Analysis of dopamine in brain tissue of mice

In this experiment, dopamine was detected in mouse brains of different groups. Eight-week-old male AP0E mice (25–28 g) were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd and randomly divided into four groups: high-fat diet and potassium perfluorooctane sulfonate administration group, common diet and potassium perfluorooctane sulfonate administration group, high-fat diet and sodium carboxymethyl cellulose control group, common diet and sodium carboxymethyl cellulose control group. Potassium perfluorooctane sulfonate (5 mg/kg) and 0.5% sodium carboxymethyl cellulose (0.1 mL/10 g) were given to the administration group and control group respectively. Mice were killed after continuous gavage for 8 weeks. Their brain tissues were added 7.5 mL/g phosphate buffer saline and homogenated for 30 s, followed by centrifugation at 14,000 r/min for 15 min (4 °C). Perchloric acid precipitant was added at a 2:1 ratio and centrifuged at 14,000 r/min for 15 min in the low temperature. The supernatant was taken for further RRS and ELISA analysis. ELISA was carried by Sevier Biotech Co., Ltd.

3.1 Detection mechanism of the RRS aptasensor

The detection mechanism of the RRS aptasensor for dopamine was shown in Scheme 1. The designed hairpin DNA was composed of three parts: a region that binds to the aptamer, a c-myc sequence which is capable of forming a parallel stranded G-quadruplex, and a region complementary to the stem. If dopamine is present in the solution, the binding of dopamine to aptamer will cause a separation for apatamer from hairpin DNA. As it was well known, Exo Ш preferentially excises a single oligonucleotide from the 3′ hydroxyl end of double-stranded DNA (dsDNA), of which the preferred substrates are blunt or recessed 3′ - termini of dsDNA, while 3′ protruding termini and single-strand DNA are resistant to Exo Ш (Jiang et al., 2018; Shevelev and Hübscher, 2002). As a result, the enzymatic reaction was triggered and the double-strand part of hairpin was cleaved, leaving the G-rich of the c-myc sequence remained and forming a single-stranded DNA of a parallel G-quadruplex which is not digested by the enzyme. Incubated in a solution rich in magnesium ions and potassium ions at low temperatures, G-quadruplexes will gradually stack to form a G-wire super nanostructure, which can significantly enhance the RRS intensity. Contrastively, in the absence of dopamine, the binding for aptamer to the hairpin DNA and the enzymatic cleavage reaction will not occur. Consequently, no forming of G-wire will not cause the change of RRS intensity.

Close

Scheme 1

Schematic diagram of the experimental design of dopamine detection using a resonance Rayleigh scattering aptasensor.

Export to PPT

3.2 Feasibility analysis

To verify the feasibility of the designed aptasensor, the RRS intensity was compared in the presence and absence of dopamine. As shown in Fig. 1A, in the absence of dopamine, the aptamer complemented to the 5′- end base of the hairpin DNA to form a stable double-stranded DNA, which was shown as curve a in the RRS spectrum. The RRS of the peak is 1212. Because the peak appeared at 363 nm, the RRS intensity was measured at 363 nm in the following experiments. Comparatively, in the presence of dopamine, the RRS intensity was significantly increased, which was shown as curve b. The peak height at 363 nm is 4612. The significant increasing in RRS intensity was probably because that the aptamer preferentially bound to dopamine and released from the hairpin DNA. As a result, digestion of the Exo Ш was triggered and the formation of G - wires obviously enhanced the RRS intensity under the aid of magnesium and potassium ions. Basing on the above results, further experimental researches were carried out.

Close

Fig. 1

(A) Typical RRS spectra of (a) hairpin DNA + aptamer + Exo Ш + Mg²⁺ and (b) hairpin DNA + aptamer + dopamine + Exo Ш + Mg²⁺. (B) PAGE analysis: (1) DNA marker; (2) hairpin DNA (3.0 μM); (3) aptamer (3.0 μM); (4) hairpin (3.0 μM) + aptamer (3.0 μM) + DA(10.0 nM) + Exo Ш(6.0 U/µL) + Mg²⁺(200.0 mM). (The concentrations of dopamine, hairpin DNA, aptamer, Exo Ш and Mg²⁺ were 10.0 nM, 3.0 μM, 3.0 μM, 6.0 U/µL, and 200.0 mM, respectively. The reaction time of hairpin DNA and aptamer was 120 min. The reaction temperature of Exo Ш was 4 °C. The quantity of bases in the complementary pairing of the hairpin DNA and aptamer was 3. The reaction time of Mg²⁺ was 120 min. The pH of the Tris-HCl buffer solution was 7.4.)

Export to PPT

The feasibility of this strategy was further verified by polyacrylamide gel electrophoresis. The result was shown in Fig. 1B. Lane 1 represented the DNA marker, and lanes 2 and 3 represented the hairpin DNA and aptamer, respectively, at concentrations of 3.0 μM. When hairpin DNA, aptamer, dopamine, Exo Ш, Mg²⁺ and K⁺ were mixed together, experiments were carried out according to the protocol mentioned above, and the electropherogram of the results was shown as lane 4. The position of the band below was higher than that of lane 3 and lane 2, indicating that the hairpin DNA and the aptamer formed a double-stranded DNA. There was a band at the base pair about 220, indicating that Exo III cut hairpin DNA and formed G-wires at the higher bands.

The above experimental characterization showed that the G-quadruplex nanowires were successfully formed and RRS aptasensor based on the formation of G-quadruplex nanowires was successfully applied in dopamine detection.

3.3 Optimization of hairpin DNA and aptamer reactions

The coupled reaction time of aptamer with hairpin DNA was a pivotal factor that affects dopamine detection by the designed aptasensor. The effects of different reaction times on the RRS intensity were compared. The aptamer that bound to the hairpin DNA acted as a recognition probe for dopamine, and poor combination of them will affect the dopamine test results directly. The solution in absence of dopamine was carried out as a blank sample under the same conditions, and the RRS signal was as the respective background. The results, as shown in Fig. S1a, showed that the RRS intensity (ΔI) gradually increased with the reaction time of aptamer with hairpin DNA in the range of 30–120 min, and reached the maximum at 120 min. As it was known, the dopamine was detected according to the difference of signals between the solutions in absence and presence of dopamine. However, if hairpin DNA was not completely combined with apatamer, the Exo III digestion was then triggered to increase the signal of background. As a result, the signal of dopamine will be decreased. Nevertheless, with the extension of combination time, the degree of reaction completeness was improved. So, when the signal maximum arrived at 120 min, the aptamer was completely combined with hairpin DNA, and then the signal was almost stable. Considering the above result, 120 min was chosen as the optimal reaction time for aptamer with hairpin DNA.

In addition, the quantity effect of complementary bases of hairpin DNAs on the dopamine assay was investigated and the results were shown in Fig. S1b. The sequences of hairpin DNA of different quantities of complementary bases were shown in Table S1. A nucleic acid aptamer specifically binds to a target substance by a weak interaction between molecules such as electrostatic interaction, hydrogen bonding, and van der Waals force (Hu et al., 2012). As shown in Fig. S1b, the RRS intensity (ΔI) decreased with the quantity of complementary base increasing. As it is well known, the more complementary bases in hairpin DNA, the stronger interaction they have between the aptamer and the hairpin DNA. So, it was not easy for aptamer to detach from hairpin DNA. Therefore, the experiment was performed by adopting the sequence of the hairpin DNA which was complementary to aptamer with three pairing bases.

3.4 Effect of Mg²⁺ concentration

Parallel stranded G-quadruplexes are capable of forming a higher structure with G-wire nanostructures in magnesium ion solutions (Shi et al., 2013), so the concentration of Mg²⁺ is an important condition to be optimized. Tris–HCl buffer solution B containing Mg²⁺ of different concentrations was prepared for the experiment to study the effect of Mg²⁺ concentration on the RRS intensity of dopamine. Because the increased RRS intensity of G-wires can be used as a detection signal for dopamine, the formation of G-wires was a crucial condition to detect dopamine. As Mg²⁺ can induce G-quadruplex stacking to form G-wires (Miyoshi et al., 2003), the concentration of Mg²⁺ was optimized. As shown in Fig. S2, the intensity of RRS (ΔI) gradually increased with the concentration of Mg²⁺ rising in the range of 40.0–200.0 mM, and stabilized when it exceeded 200.0 mM, indicating a saturated concentration has been arrived. Therefore, Tris–HCl buffer solution B was prepared by choosing the Mg²⁺concentration of 200.0 mM.

3.5 Effect of Exo III activity

The activity of Exo III was also a pivotal factor for the detection of dopamine by the designed aptasensor. Here, the effects of Exo III on the RRS intensity were optimized, including the Exo III reaction temperature and its concentration. Because the initiation of the enzyme digestion was an important prerequisite to release the G-quadruplex sequence of the hairpin DNA, so whether Exo III maintained a good activity at a suitable temperature was very effective to perform enzymatic cleavage. As shown in Fig. S3a, the RRS (ΔI) intensity gradually decreased with the Exo III reaction temperature rising in the range of 4 °C to 50 °C, and slightly increased in the range of 50–60 °C. The above results might be due to the fact that the enhancement of the temperature probably caused the dissociation of aptamer from hairpin DNA even in absence of dopamine. However, the concentration of dopamine was quantified according to the intensity difference between the dopamine solutions and blank. As a result, the rising of blank signals led to RRS intensity decreasing. But when the temperature was over 50 °C, the activity of the enzyme was gradually destroyed and the RRS (ΔI) showed a little increasing. Therefore, 4 °C was chosen as the optimum reaction temperature for Exo III. The effects of different Exo III concentrations on the RRS intensity were further investigated. As shown in Fig. S3b, the RRS (ΔI) value increased with Exo III concentration increasing and reached a plateau at 6.0 U/μL. Therefore, 6.0 U/μL of Exo Ш was selected in the following experiment.

3.6 Analytical performance of the dopamine aptasensor

Dopamine concentration assay was performed using RRS aptasensor under optimized experimental conditions. As shown in Fig. 2, with the increase of dopamine concentration, the RRS intensity was gradually enhanced in the wavelength range of 220–650 nm and all the responses were obviously higher than those in the absence of dopamine. Under the optimized conditions, the RRS intensity showed a good linear relationship with the natural logarithm of dopamine concentration in the range of 0.05–10.0 nM. The linear equation is ΔI = 1880.2 + 591.19ln(C), the correlation coefficient r is 0.995, and ΔI and C represent RRS intensity and dopamine concentration, respectively. The calculated detection limit was 0.01 nM (3 s/D). The limit of detection referred to three-fold of the standard deviation of the blank concentrations and divided by the slope (where s was the standard deviation of the blank solutions, n = 15). The results of this method compared with previous methods were shown in Table 1. The detection limit of this method is 0.012 nM. Compared with the electrochemical method (Alvarez-Martos and Ferapontova, 2016; Azadbakht et al., 2016), this method shows a better sensitivity. There are also many fluorescent aptamer sensors for dopamine detection (Huang et al., 2016; Xu et al., 2015). This strategy detected dopamine by forming G-wires and detecting RRS intensity, which needed not to introduce special quantum dots, fluorescence quenching or fluorescence resonance energy transfer, which was good for the environment and more intuitive.

Close

Fig. 2

RRS spectra of aptamer sensors with different concentrations of dopamine. (a) 0.0 nM, (b) 0.05 nM, (c) 0.07 nM, (d) 0.09 nM, (e) 0.2 nM, (f) 0.4 nM, (g) 0.6 nM, (h) 0.6 nM, (i) 0.8 nM, (j) 1.0 nM, (k) 3.0 nM, (l) 5.0 nM, (m) 8.0 nM, (n) 10.0 nM. (The reaction time of hairpin DNA and aptamer was 120 min. The reaction temperature of Exo Ш was 4 °C. The quantity of bases in the complementary pairing of hairpin DNA and aptamer was 3. The reaction time of Mg²⁺ was 120 min. The pH of the Tris-HCl buffer solution was 7.4.)

Export to PPT

3.7 Selectivity of the RRS aptasensor for dopamine detection.

To investigate the selectivity of this method, the RRS intensity of 10.0 nM dopamine solution was detected which contained various interfering substances (uric acid, ascorbic acid, epinephrine, glucose and serotonin). The concentration of the interferences was 50.0 nM. A dopamine solution containing no interference was also determined as a comparison. As can be seen from Fig. 3, uric acid, ascorbic acid, epinephrine, glucose, and serotonin hardly showed interfere with the determination of dopamine. The relative error of ±5% was taken as the interference limit. The results showed this method had an excellent selectivity.

Close

Fig. 3

Selectivity of the proposed RRS aptasensor for 10.0 nM dopamine from 50.0 nM ascorbic acid, 50.0 nM glucose, 50.0 nM uric acid, 50.0 nM epinephrine, and 50.0 nM serotonin. (The concentrations of hairpin DNA, aptamer and Mg²⁺ were 3.0 µM, 3.0 µM, and 200.0 mM, respectively. The reaction time of hairpin DNA and aptamer was 120 min. The reaction temperature of Exo Ш was 4 °C. The quantity of bases in the complementary pairing of hairpin DNA and aptamer was 3. The reaction time of Mg²⁺ was 120 min. The pH of the Tris-HCl buffer solution was 7.4.).

Export to PPT

3.8 Analysis of dopamine in real samples

To evaluate the validity and suitability of the designed RRS aptasensor in real samples, the dopamine concentration in mouse brain tissue was determined using the classical ELISA method and the RRS aptasensor method, respectively. After a statistical analysis, the results were shown in Table 2. The difference between these two methods showed no statistical significance and had a good consistency (P = 0.496 > 0.1). We randomly selected an actual sample and added four concentrations of standard dopamine solutions of low, middle and high to measure the intra-day precision. As shown in Table 3, the recoveries of the spiked samples and relative standard deviation ranged within 80.00–91.67% and 1.28–2.56%, respectively. Therefore, the designed RRS aptasensor can be successfully used for the detection of dopamine in actual samples.