Translate this page into:
Development of doxorubicin-loaded chitosan–heparin nanoparticles with selective anticancer efficacy against gastric cancer cells in vitro through regulation of intrinsic apoptosis pathway
⁎Corresponding author at: No.1 Eastern Jianshe Road, Zhengzhou, Henan 450052, PR China. huiyuyang@126.com (Huiyu Yang)
-
Received: ,
Accepted: ,
This article was originally published by Elsevier and was migrated to Scientific Scholar after the change of Publisher.
Abstract
Chitosan–heparin nanoparticles (CS-HP NPs) can be used as potential nano-based platforms for development of drug delivery carriers. In this article, doxorubicin (Dox)@CS-HP NPs were synthesized and their physicochemical characteristics were assessed. Afterwards, their anticancer effects against gastric cancer (AGS) cells were assessed by MTT, LDH, ROS, and qPCR assays, whereas peripheral blood mononuclear cells (PBMCs) were used as control normal cells. It was observed that blank CS-HP NPs and Dox@CS-HP NPs showed average hydrodynamic sizes and zeta potential values of 72.95 ± 9.67 nm (PDI: 0.197), 79.68 ± 13.11 nm (PDI: 0.227) and 23.68 ± 3.69 mV, 19.37 ± 2.38 mV, respectively and Dox loading capacity (LC) in the CS-HP NPs was 7.3 ± 1.29% with an entrapment efficacy (EE) of 91.37 ± 5.27%. It was also seen that lowering the pH to within the range of cancer cells (pH 6.5) and gastric cells (pH 1.5) stimulated substantial release of the drug from Dox@CS-HP NPs relative to physiological pH. The IC50 values of Dox and Dox@CS-HP NPs were observed to be 23.37, 26.14 µg/ml and 8.57, 4.21 µg/ml in the case of PBMCs and AGS cells, respectively. It was also showed that Dox@CS-HP NPs increased the LDH release, intracellular reactive oxygen species (ROS), mRNA levels of Bax/Bcl-2, caspase-9, and caspase-3, while did not change the expression of caspase-8 at mRNA level, indicating that Dox@CS-HP NPs activates the intrinsic apoptotic pathway. In general, it can be concluded that Dox@CS-HP NPs can induces selective anticancer effects on AGS cells.
Keywords
Chitosan
Heparin, doxorubicin
Gastric cancer
Anticancer
1 Introduction
Gastric (stomach) cancers are known as one the most common cancers in the world and according to the results reported by the World Health Organization (WHO) among the factors that are associated with an increased risk of gastric cancer can be Helicobacter pylori infection, smoking, alcohol, obesity, and dementia (Tsugane and Sasazuki, 2007).
In chemotherapy, cytotoxic drugs are used as potential anticancer agents which are affecting the cell cycle arrest of cancer cells mediated by producing free radicals through increasing the rate of apoptosis (Kohn et al., 1994). One of the effective drugs in the chemotherapy process is a four-ring compound called doxorubicin (Dox), which has a poor solubility in water and high stability in humidity and high temperatures (Kalaria et al., 2009). Dox belongs to the anthracycline antibiotics, which causes a physical disorder in the function of the topoisomerase II due to its high affinity for DNA binding, which finally results in the disruption of cell replication (Tacar et al., 2013).
Although Dox is used to treat a wide range of cancers, it has many side effects due to the non-targeted nature of chemotherapy (Carvalho et al., 2009). Therefore, its clinical use has been challenged due to its high unwanted adverse effects and the emergence of drug resistance (Carvalho et al., 2009).
Therefore, nanomedicine seeks to use tools and nanocarriers that interact with the body at the molecular level, thereby increasing the effectiveness of treatment and inhibiting the side effects by targeted drug delivery (Sun et al., 2017).
Among them, chitosan-heparin nanoparticles (CS-HP NPs) can be mentioned as new strategies for drug delivery to cancerous tissues (Kumar et al., 2016; Shahbazi et al., 2013; Lin et al., 2013; Thomas et al., 2013).
Heparin is one of the most important natural polymers that can be integrated into the nanoplatforms for specific biomedical applications (Rodriguez-Torres et al., 2018; Afratis et al., 2017). For example, it has been shown that targeted delivery of anticancer drug can be achieved to lung cancer employing peptide-HP-drug NPs (Peng et al., 2011) or HP/CaCO3/CaP hybrid nanocarriers with controllable morphological features can be used for anticancer drug delivery (Liang et al., 2013). Also, it has been shown that HP- based NPs can be used for metastatic breast cancer therapy (Mei et al., 2017; Sun et al., 2018; Newland et al., 2020), intracellular delivery of drugs in cancer cells (Emami et al., 2020), and combined chemotherapy-photodynamic therapy of cancer cells (Khaliq et al., 2018). CS polymers with positive charges could react spontaneously with HP, which is a negatively charged molecule, and form a nano-based complex. Indeed, CS-HP NPs loaded with different drugs can be used as pH-sensitive nanoplatforms (Thomas et al., 2013) for the treatments of a cancer (Lai et al., 2014). Also, it has been indicated that CS-HP NPs show potential blood compatibility and biocompatibility (Mohammadi et al., 2019).
Due to the widespread prevalence of gastric cancer in the world and the significant clinical and social consequences and the imposition of treatment costs, as well as the need to study the effects of various drugs formulation, in the present study, we aimed to prepare the Dox-loaded-CS-HP NPs and evaluate their anticancer effects against gastric cancer cell line (AGS).
2 Materials and methods
2.1 Materials
RPMI 1640 medium, fetal bovine serum (FBS), chitosan (60–90 kDa), heparin, 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT), and doxorubicin were obtained from Sigma-Aldrich Co. (St Louis, MO, USA). All other materials were of analytical grade.
2.2 Particle preparation
CS-HP NPs were synthesized based on polyelectrolyte interaction between CS (cation) and HP (anion). Before interaction HP was hydrated in deionized water with a concentration of 1 mg/mL, while CS was hydrated in acetic acid (0.01%, pH: 6) with a concentration of 2 mg/mL and sonicated (10% power) for 2 min. Afterwards, HP solution was added to CS solution dropwise under constant stirring (100 rpm) at ambient temperature. To encapsulate Dox inside CS-HP NPs (abbreviated as: Dox@CS-HP NPs), the drug was added to CS solution after sonication under stirring; thereafter the prepared solution was added by HP. The prepared NPs were collected by centrifugation at 15,000 rpm for 20 min.
2.3 Particle structure
Hydrodynamic radius, polydispersity index (PDI) and zeta potential of prepared samples were evaluated by dynamic light scattering (DLS) employing a Zetasizer Nano ZS (Malvern, Worcester, UK) at room temperature.
2.4 Drug loading efficiency
Dox-loaded NPs were obtained by adding 1 mg of Dox to CS solution before interaction with HP. To calculate the loading capacity (LC) of Dox into CS-HP NPs, the free drug was separated from the loaded samples employing centrifugation (12,000 × g at 4 °C for 10 min). The filtered samples with free drug were collected and assessed using multimode microplate reader (BioRad, USA) at λex and λem of 470 and 595 nm, respectively and the LC and entrapment efficiency (EE) were estimated with a linear calibration curve based on the reported equations (Tan et al., 2011).
2.5 Drug release assay in vitro
In vitro release of Dox from CS-HP NPs and CS complex was assessed for 24 h employing 50 μL of drug-loaded samples diluted with 450 μL of the release solution. The release solutions were: the simulated gastric fluid was 0.1 mol/L HCl (100 mM, pH 1.5) supplemented with 0.5% Tween-80, the simulated intestinal fluid was PBS buffer (25 mM, pH 6.5) containing 0.5% Tween-80, and the simulated physiological buffer was PBS (150 mM, pH 7.4) containing 0.5% Tween-80, in Eppendorf tubes and shaken at 37 °C and 300 rpm. At different time intervals, the tubes were centrifuged (12,000 × g, 10 min). The filtrates were then collected for fluorescent assay to calculate the content of released Dox (λex = 470 nm, λem = 595 nm).
2.6 Cell culture
Human gastric carcinoma cell line (AGS) and fresh peripheral blood mononuclear cells (PBMCs) which isolated based on density gradient centrifugation in Ficoll-Paque (Zivari Fard et al., 2020) based on ethics approval by Zhengzhou University, Zhengzhou, China, were cultured in RPMI 1640 medium supplemented with FBS (10%), and 1% antibiotic–antimycotic solution. The cells were then incubated at 37 °C with 5% CO2.
2.7 Anticancer assay
The anticancer and cytotoxicity effects of prepared Dox@CS-HP NPs against AGS and PBMCs cells were explored using MTT assay. The cells were seeded into 96-well plates at density of 104 cells per well. After 24 h, Dox@CS-HP NPs and CS-HP NPs were added to the cell culture medium at various Dox concentrations ranging from 0.01 to 40 μg mL−1 for 48 h. Then, 100 μL MTT solution (5 mg/mL in PBS) was added for 4 h. The supernatant was then carefully withdrawn and cells were added by 100 μL DMSO for 3 min. The absorbance of the samples was read at 540 nm using a microplate reader (BIO-RAD microplate reader-550) at 570 nm. The solution was used in the preparation of Dox@CS-HP NPs was used as solvent control.
2.8 LDH release
Both normal and cancer cells were treated by the IC50 concentration of Dox@CS-HP NPs (4.21 µg/ml) for 24 h, and the LDH activity was then assessed by employing a commercially available kit (Sigma, USA) using a microplate reader (BIO-RAD microplate reader-550) at 450 nm.
2.9 Flow cytometry assay
ROS generation assay was assessed using dichlorodihydrofluorescein diacetate (DCFDA, 5 μM). After treatment, the cells were washed, stained, incubated at 37 °C for 30 min, and measured employing a flow cytometer (Becton Dickinson, BDAccury).
2.10 qPCR assay
Total RNA was isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific) and cDNA was synthesized with a Takara Bio kit (Japan). Then, qPCR assay was done based on SYBR Green PCR Master Mix. Table 1 summarizes the primers were designed in the present study. The qPCR assay was finally done using an ABI system (PRISM 7500; Thermo Fisher Scientific, Inc.) based on the 2-ΔΔCt method (Schmittgen and Livak, 2008).
Primer
Forward
Reverse
Bax
5′-CAGGATGCGTCCACCAAGAA-3′
5′-CGTGTCCACGTCAGCAATCA-3′
Bcl-2
5′-GGATGCCTTTGTGGAACTGT-3′
5′-AGCCTGCAGCTTTGTTTCAT-3′
Caspase-9
5′-TACAGCTGTTCAGACTCTAGTA-3′
5′-AAATATGTCCTGGGGTAT-3′
Caspase-8
5′-CTACCAACTCATGGACCACAG-3′
5′-GTGACTGGATGTACCAGGTTC-3′
Caspase-3
5′-TATGGTTTTGTGATGTTTGTCC −3′
5′-TAGATCCAGGGGCATTGTAG-3′
GAPDH
5′–TGCACCACCAACTGCTT AGC–3′
5′–GGCATGGACTGTGGTCATGAG–3′
2.11 Caspase-3 activity assay
After treatment of the cells with IC50 concentration of Dox@CS-HP NPs (4.21 µg/ml) for 24 h, the cells were homogenized and the protein concentration was determined by BCA available e kt (Sigma, UDA). Afterward, 50 µg of protein were used for caspase-3 activity with a commercially available kit (Sigma, USA) using a microplate reader (BIO-RAD microplate reader-550) at 405 nm.
2.12 Statistical analysis
The data were expressed as mean ± standard deviation (SD) and the student t-test and one way ANOVA was used for comparison of data using SPSS software.
3 Results
3.1 Characterization of Dox@CS-HP NPs
The hydrodynamic radius (Fig. 1A) and zeta-potential (Fig. 1B) of the prepared CS-HP NPs and Dox@CS-HP NPs were explored employing DLS. As depicted in Fig. 1A, the blank CS-HP NPs and Dox@CS-HP NPs showed averaged hydrodynamic sizes of 72.95 ± 9.67 nm (PDI: 0.197) and 79.68 ± 13.11 nm (PDI: 0.227), respectively. Also, zeta potential values (Fig. 1B) were determined to be 23.68 ± 3.69 mV and 19.37 ± 2.38 mV for blank CS-HP NPs and Dox@CS-HP NPs, respectively.
(A) Particle size distribution of CS-HP NPs (solid line) and Dox@CS-HP NPs (dotted line). (B) Zeta potential values of CS-HP NPs (solid line) and Dox@CS-HP NPs (dotted line).
It was also indicated that the Dox-LC in the CS-HP NPs was 7.3 ± 1.29% with an EE of 91.37 ± 5.27% which was estimated based on fluorescence measurement using a calibration curve.
3.2 In vitro Dox release
It was seen that naked CS-HP NPs had a burst of Dox release within the first 3 h (Fig. 2A) at pH 7.4, which is associated with dissociation of Dox attached to the surface of the CS-HP NPs. This phase was followed by a continuous release of Dox until 24 h, due to a combination of Dox diffusion from the CS-HP NP structure and CS-HP degradation. Since during the endocytic penetration of NPs into cancer cells, they will be exposed to a weakly acidic environment (pH 6.5), we assessed the effects of a weakly acidic medium on the release of Dox from CS-HP NPs (Fig. 2B). At pH 6.5, a significant retention in drug release was observed relative to free drug, indicating that the CS-HP NPs will potentially release their chemotherapeutic drug within the mildly acidic microenvironment of cancer cells in a sustained fashion. Lowering the pH to within the range of gastric cells (pH 1.5) stimulated substantial release of the dox drug (85 ± 3.66% release at 12 h) (Fig. 2C). The cargo release at acidic conditions can be due to decomposition of the CS-HP core. Indeed, in acidic pH, as CS becomes cationic, a substantial content of the Dox is released from the NPs, indicating that the acidic microenvironment of cancer cells increases the potential release of the Dox cargo.
In vitro drug release profiles of free Dox and Dox@CS-HP NPs at (A) (pH 7.4), (B) pH 6.5, (C) pH 1.5 at 37 °C. Data are presented as means ± SD (n = 5).
3.3 MTT assay
The anticancer impact of blank NPs, Dox and Dox@CS-HP NPs in AGS gastric cancer cells was explored by MTT assay, whereas the PBMCs were used as the normal cells. As shown in Fig. 3A and B, free Dox and Dox@CS-HP NPs showed a typical dose-dependent toxic impact in both cancer and normal cells, respectively. However, Dox@CS-HP NPs demonstrated a more promising anticancer impact relative to that of free Dox after 24 h (Fig. 3A). The data indicated that the NPs platform not only resulted in the maintenance of the pharmacological function of Dox, but also increased its anticancer effect. IC50 values were then determined to compare the influences of the Dox formulation on both normal and cancer cells. The IC50 values of Dox and Dox@CS-HP NPs were observed to be 23.37, 26.14 µg/ml and 8.57, 4.21 µg/ml in the case of PBMCs and AGS cells, respectively, which indicated the more significant cytotoxic effects of both free and Dox@CS-HP NPs against AGS cells in comparison with those of drugs against PBMCs (Fig. 3 C) (***P < 0.001). Also, the superior anticancer activity of Dox@CS-HP NPs relative to free dug (**P < 0.01) may be associated with the weakly acidic environment and sustained release of Dox in the intracellular microenvironment of cancer cells. Indeed, following cellular uptake, Dox encapsulated in the CS-HP NPs may be continually released, thereby increasing the concentration of active drug for a determined time period. The data showed that the cytotoxic effects of Dox@CS-HP NPs against PBMCs are less than free Dox, although it was not significantly different. In addition, both normal and cancer cells incubated with blank NPs revealed a small portion of mortality at all the concentrations assessed, suggesting the safety and potential biocompatibility of the developed NPs.
(A) Cytotoxicity assay of AGS cells treated with increasing concentrations (0.01–40 µg/mL) of CS-HP NPs, Dox, Dox@CS-HP NPs for 24 h. (B) Cytotoxicity assay of PBMCs cells treated with increasing concentrations (0.01–40 µg/mL) of CS-HP NPs, Dox, Dox@CS-HP NPs for 24 h. (C) Determination of IC50 concentrations. (D) LDH assay of AGS cells and PBMCs incubated with IC50 concentration of Dox@CS-HP NPs (4.21 µg/ml) for 24 h. Data are presented as means ± SD (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001: relative to control group; #P < 0.05, ##P < 0.01: relative to Dox-incubated cells.
The cytotoxic effects of free Dox and Dox@CS-HP NPs were further evaluated by LDH assay (Fig. 3D). In this assay, the cells were incubated with IC50 concentration (4.21 µg/ml). It was indicated that the negative control cells maintained their membrane integrity, however, Dox@CS-HP NPs triggered a higher LDH release in AGC cells, compared with those of free Dox (*P < 0.05) and PBMCs (**P < 0.01).
3.4 Flow cytometry assay for quantification of ROS
Free Dox (4.21 µg/ml) or Dox@CS-HP NPs (4.21 µg/ml) treatments caused a significant enhancement in the level of intracellular ROS (Fig. 4A, B) in AGS cells. It was seen that both free and Dox@CS-HP NPs triggered a significant increase in the intracellular ROS as evinced from increased DCF fluorescence intensity (Fig. 4A, B). However, it was seen that this increase in the level of ROS production was more significant for Dox@CS-HP NPs-treated AGS cells that of Dox-treated cells (*P < 0.05) (Fig. 4B).
(A) ROS assay of cells treated with Dox@CS-HP NPs (4.21 µg/ml) or Dox (4.21 µg/ml), or Dox@CS-HP NPs (4.21 µg/ml) and NAC (5 µM) for 24 h (B) Quantification of DCF intensity. Data are presented as means ± SD (n = 5). *P < 0.05, **P < 0.01: relative to control group.
Also, co-incubation with NAC (5 µM) as a potential antioxidant significantly (**P < 0.01) prevented Dox@CS-HP NPs mediated ROS production (Fig. 4), indicating that ROS may play a crucial effect in the anticancer activity of Dox.
3.5 qPCR assay
The relative expression levels of Bax/Bcl-2 mRNA ratio and caspase-9/8/3 mRNA can be used as crucial indicators of apoptosis. Treatment of AGS cells with free Dox and Dox@CS-HP NPs caused a significant increase in relative expression level of Bax/Bcl-2 mRNA ratio (Fig. 5A). Further, free Dox and Dox@CS-HP NPs treatment significantly increased the expression level of caspase-9 (Fig. 5B), whereas they did not significantly change the expression level of caspase-8 (Fig. 5C) in AGS cells. Also, caspase-3 mRNA (Fig. 5D) and caspase 3 activity (Fig. 5E) levels in AGC cells were significantly increased upon treatment of the cells with both free Dox and Dox@CS-HP NPs. Moreover, in all assays, it was observed that both free Dox and Dox@CS-HP NPs with the applied concentration did not change the expression level of tested mRNA in PBMCs. Also, it was realized that the potential effects of Dox@CS-HP NPs was more pronounced than free Dox and co-incubation of cells with NAC (5 µM), resulted in the inhibition of apoptotic effects of Dox@CS-HP NPs in AGS cells. This data indicated that both free Dox and Dox@CS-HP NPs stimulate mitochondrial-mediated apoptosis by overexpression of Bax/Bcl-2 mRNA ratio and caspase-9 mRNA and activity.
(A) Relative Bax/Bcl-2 mRNA ratio, (B) Relative caspase-9 mRNA, (C) Relative caspase-8 mRNA, (D) Relative caspase-3 mRNA assays determined by qPCR assay. (E) Quantification of caspase-3 activity of cells. The cells were treated with Dox@CS-HP NPs (4.21 µg/ml) or Dox (4.21 µg/ml), or Dox@CS-HP NPs (4.21 µg/ml) and NAC (5 µM) for 24 h. Data are presented as means ± SD (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001: relative to control group.
4 Discussion
The present study showed that nano-formulation of Dox by CS-HP NPs can increase the AGS cell sensitivity to this apoptosis-inducing agent. AGS cells, which are relatively resistant to a number of chemotherapeutic drugs (Camp et al., 2004), show higher sensitivity to Dox when this drug is encapsulated by CS-HP NPs. Also, it was shown that increase of Dox@CS-HP NPs more vigorously than free Dox results in the LDH release, generation of ROS, overexpression of Bax/Bcl-2 mRNA and caspase-9/3 mRNA level, and upregulation of caspase-3 activity, which indicate that nano-formulation of Dox can play a key role in drug-triggered intrinsic apoptosis mediated by ROS generation in AGS cells, where, it shows minimum side effects on the normal cells. These selective effects by Dox@CS-HP NPs may be due to the fact that nanotechnology in the drug delivery system has a great impact on the selective recognition of cancer cells, targeted drug delivery in cancer cells and overcoming the limitations of conventional chemotherapy (Kamath, 2017; Borkowska et al., 2020; Zeinizade et al., 2018 Oct 31). pH-sensitive sustained drug release prevents anticancer substances from affecting other healthy organs, thereby reducing side effects and problems with repeated use of the drug (Belali et al., 2018; Gooneh-Farahani et al., 2019).
Unlike conventional chemotherapy, which targets both healthy and cancer cells, the anti-cancer drug Dox, which is carried on the CS-HP nanocarriers, showed a significant sustained release at pH 6.5 relative to that of physiological pH, indicating that the CS-HP NPs will potentially release their chemotherapeutic drug within the mildly acidic microenvironment of cancer cells.
To date, some Dox-based nanostructures have been designed and assessed to improve the potency of gastric carcinoma chemotherapy (Fang et al., 2018; Zheng et al., 2020; Mi et al., 2018; Zhao and Zhang, 2018). Many drug studies have focused exclusively on the uptake of drugs into CS-HP nanostructures (Thomas et al., 2013; Lai et al., 2014), and have not addressed the more important issue of drug release from nanocarriers in the vicinity of cancer cells as well as their anticancer mechanism. Due to the fact that cancer tissues have an acidic environment, in the study, after preparation of CS-HP NPs and corresponding drug loading, the release of the drug through protonation was analyzed. The results of the present project confirm the ability of CS-HP synthesized nanocarriers as a promising carrier for the selective delivery and release of Dox anticancer drug in the treatment of gastric cancer.
5 Conclusion
In the present study CS-HP NPs loaded with Dox were successfully prepared and their physicochemical properties as well as sustained drug release at different pH mediums were assessed. Afterwards, it was seen that Dox@CS-HP NPs induces selective anticancer effects on AGS cells through intrinsic-dependent apoptosis by intracellular generation of ROS, upregulation of Bax/Bcl-2 mRNA ratio and caspase-9/3 mRNA. However, further investigations are warranted to explore the pre-clinical and clinical aspects of these nanocarriers.
Funding
Key projects jointly constructed by Henan province and State Ministry of Health (No. SBGJ202002063)
Acknowledgements
We would like to thank the State Key Laboratory of Esophageal Cancer Prevention & Treatment, Zhengzhou University for providing us with the experimental site and equipments in this study.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
References
- Diet and the risk of gastric cancer: review of epidemiological evidence. Gastric Cancer. 2007;10(2):75-83.
- [Google Scholar]
- Design of biodegradable nanoparticles for oral delivery of doxorubicin: in vivo pharmacokinetics and toxicity studies in rats. Pharm. Res.. 2009;26(3):492-501.
- [Google Scholar]
- Doxorubicin: an update on anticancer molecular action, toxicity and novel drug delivery systems. J. Pharm. Pharmacol.. 2013;65(2):157-170.
- [Google Scholar]
- Doxorubicin: the good, the bad and the ugly effect. Curr. Med. Chem.. 2009;16(25):3267-3285.
- [Google Scholar]
- RGD Peptide-Based Target Drug Delivery of Doxorubicin Nanomedicine. Drug Dev. Res.. 2017;78(6):283-291.
- [Google Scholar]
- Ciprofloxacin loaded genipin cross-linked chitosan/heparin nanoparticles for drug delivery application. Mater. Lett.. 2016;180:119-122.
- [Google Scholar]
- Preparation, optimization, and in-vitro/in-vivo/ex-vivo characterization of chitosan-heparin nanoparticles: drug-induced gelation. J. Pharm. Pharmacol.. 2013;65(8):1118-1133.
- [Google Scholar]
- Genipin-cross-linked fucose–chitosan/heparin nanoparticles for the eradication of Helicobacter pylori. Biomaterials. 2013;34(18):4466-4479.
- [Google Scholar]
- Intracellular delivery of doxorubicin encapsulated in novel pH-responsive chitosan/heparin nanocapsules. Int. J. Nanomed.. 2013;8:267-275.
- [Google Scholar]
- Heparin-based nanoparticles: An overview of their applications. Journal of Nanomaterials. 2018;1:1-7.
- [Google Scholar]
- The role of heparins and nano-heparins as therapeutic tool in breast cancer. Glycoconj. J.. 2017;34(3):299-307.
- [Google Scholar]
- Targeted delivery of cisplatin to lung cancer using ScFvEGFR-heparin-cisplatin nanoparticles. ACS Nano. 2011;5(12):9480-9493.
- [Google Scholar]
- Facile preparation of heparin/CaCO3/CaP hybrid nano-carriers with controllable size for anticancer drug delivery. Colloids Surf., B. 2013;102:783-788.
- [Google Scholar]
- Polymer–drug nanoparticles combine doxorubicin carrier and heparin bioactivity functionalities for primary and metastatic cancer treatment. Mol. Pharm.. 2017;14(2):513-522.
- [Google Scholar]
- Development of low molecular weight heparin based nanoparticles for metastatic breast cancer therapy. Int. J. Biol. Macromol.. 2018;112:343-355.
- [Google Scholar]
- Focal drug administration via heparin-containing cryogel microcarriers reduces cancer growth and metastasis. Carbohydr. Polym.. 2020;245:116504-116509.
- [Google Scholar]
- Novel pH-triggered biocompatible polymeric micelles based on heparin–α-tocopherol conjugate for intracellular delivery of docetaxel in breast cancer. Pharm. Dev. Technol.. 2020;25(4):492-509.
- [Google Scholar]
- Pluronic/Heparin Nanoparticles for Chemo-Photodynamic Combination Cancer Therapy through Photoinduced Caspase-3 Activation. ACS Applied Nano Materials. 2018;1(6):2943-2952.
- [Google Scholar]
- Development of chitosan/heparin nanoparticle-encapsulated cytolethal distending toxin for gastric cancer therapy. Nanomedicine. 2014;9(6):803-817.
- [Google Scholar]
- Chitosan-heparin nanoparticle coating on anodized NiTi for improvement of blood compatibility and biocompatibility. Int. J. Biol. Macromol.. 2019;127:159-168.
- [Google Scholar]
- Controlled release of chitosan/heparin nanoparticle-delivered VEGF enhances regeneration of decellularized tissue-engineered scaffolds. Int. J. Nanomed.. 2011;6:929-935.
- [Google Scholar]
- The Investigation of the Cytotoxicity of Copper Oxide Nanoparticles on Peripheral Blood Mononuclear Cells. Nanomedicine Research Journal. 2020;5(4):364-368.
- [Google Scholar]
- Analyzing real-time PCR data by the comparative C T method. Nat. Protoc.. 2008;3(6):1101-1109.
- [Google Scholar]
- Inducible nuclear factor-κB activation contributes to chemotherapy resistance in gastric cancer. J. Am. Coll. Surg.. 2004;199(2):249-258.
- [Google Scholar]
- R Kamath, P. and Sunil, D., 2017. Nano-chitosan particles in anticancer drug delivery: an up-to-date review. Mini reviews in medicinal chemistry, 17(15), pp.1457-1487.
- Targeted crystallization of mixed-charge nanoparticles in lysosomes induces selective death of cancer cells. Nat. Nanotechnol.. 2020;15(4):331-341.
- [Google Scholar]
- Selective apoptosis induction in cancer cells using folate-conjugated gold nanoparticles and controlling the laser irradiation conditions. Artif. Cells Nanomed. Biotechnol.. 2018 Oct 31;46(sup1):1026-1038.
- [Google Scholar]
- Cell-specific and pH-sensitive nanostructure hydrogel based on chitosan as a photosensitizer carrier for selective photodynamic therapy. Int. J. Biol. Macromol.. 2018;110:437-448.
- [Google Scholar]
- A critical comparison study on the pH-sensitive nanocomposites based on graphene-grafted chitosan for cancer theragnosis. Multidisciplinary Cancer Investigation. 2019;3(1):5-16.
- [Google Scholar]
- Quercetin and doxorubicin co-delivery using mesoporous silica nanoparticles enhance the efficacy of gastric carcinoma chemotherapy. Int. J. Nanomed.. 2018;13:5113-5118.
- [Google Scholar]
- Nanoparticle mediated codelivery of nifuratel and doxorubicin for synergistic anticancer therapy through STAT3 inhibition. Colloids Surf., B. 2020;193:111109-111115.
- [Google Scholar]
- Active tumor-targeted co-delivery of epigallocatechin gallate and doxorubicin in nanoparticles for combination gastric cancer therapy. ACS Biomater. Sci. Eng.. 2018;4(8):2847-2859.
- [Google Scholar]
- Enhanced apoptosis and inhibition of gastric cancer cell invasion following treatment with LDH@ Au loaded Doxorubicin. Electron. J. Biotechnol.. 2018;32:13-18.
- [Google Scholar]
